Echinops_telfairi Locus Mono:258:SNORA44
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:258:SNORA44
Echinops_telfairi
Mono:258:SNORA44
scaffold_227621
SNORA44
1001..1116
1183
CAACAGACCCTAATGAAACAAATAAGGCCGTAGTATGAAAGACTGTAATCCAGCAATTT
CCTGGTCAGATACCTGAAAAGCACTGTCTTCACAAATGAACGCATATGGACATTACGAAT
TAGAACCTGCCCATAGCAAAAGAAGAAATAGATAAGGTCATCAAGAAACTCCCACCTTAA
AAAGCCCCAGTCCAGATGGTTTCCGAGAAAAATTCTTCCAAGTATTCAGAGAAGAGCTGA
GACCAATCCTACACAACGTCTTCCAGAACATAGAAATGGACAGCAAATTCCCAAACTCAG
TCTATAAAGCCAGCATAACCCAAACTGGACAAAGAATCCACAAGGTTAGAGAATTACAGA
TTTATATATCTCATGAACACAGGTATAAATATCCTCAACAAAATCTTGGCCAATAGAATC
CAACAATATATCATCATCATCATTATCATCATCATCATCCATCATGGCCAAGTGGGATTC
ATACCAGCCATGCAGAAATGGTTCACCATTCAACAGACAATTAATGTAATCCACCACATC
AACAAGAAAAAGTACAAGAACCATATGATCACATCAATTGATGCAGAAAATGCATTTGAT
AACATCCAACACACATTTCTAATAAAGACTCTCAAGAAGATAAGATTATAAGGGAAAATC
CTCAGTACAATAAAAGCCATATACGAAACACCAATAGCCAATATTACACTGAATGTAGAA
AAACTGAAAACGTTTACACTGAATTAGGGAACTGAACAAGGATGTCCCTTAGACAACAAC
AGCAGGATATCAAGGATGTACAATTGGGTAAAGCAGAAGTGAAACTTTCTCTATTTGCAG
ATGATATGATTTTATATATTGAGAATCCTAAGGGGTTCACAATATGATTGCTGGAACCAA
TAGAGGGGCTTAGTAGAGTAGCAGGATATAGGACTAACAAGCAGAAATCAATTGGATTTC
TATTCCTAGTGATGAGAATACAGAAAACCATATCAAGGAATCAGTACTATTCACAAAGGT
CACCTGATCTCCAAGTGCAAGCAAAAGCAATATGGAGAGATTCTGACTGCTCAGGTTAGC
AAAGTCTCTGCAGCTGCCACTCGCCTTTCCTATAACCTTCTCCAGGATCTGGGCAAGAAA
GTCCAGTTTTCCCTCAGCTTCCATGTAGATCTGGCTAGTACAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved