Echinops_telfairi Locus Mono:140:SNORA62
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:140:SNORA62
Echinops_telfairi
Mono:140:SNORA62
scaffold_319417
SNORA62
1001..1152
2152
CAACATGCATCATCAGACTGTAACTTCACTCATAGTTTTGACCCCACCCCTACTTCCAC
ACTGGTACCATCAAGTTGACATAAAATCTAATCACCATGTTTATCTCAGCATTATTCCTC
ATAGTAGGAAGATGGACACAACTTAAATGTCTGCCCATCAACAGCTGAACGGACAGAGAA
GCTGTGACATATGCAAACAATTTTATTATAATCTCCTATGGTGTCTTCCCAAACTGCTCT
TTGAAATCTTCTCTTCAGTTCTTTTGGTTCATCATTTCTTCCATTTGCTTTAGCTTCTTC
ATGTTCAAAAGTAAATTTAAATATCTTCTGTCATTCACGTTGGTATTTCCTTTATTATAT
TTTTAGTGATCATTTGCTTTCTCTATATATGCTATTCTTAATGTCATACCAGACCTTGTA
AGGTGTTAAGTCATTCATGCTTAATTCTCCAGCACAGTGGCTATGCAAGAGGATGGGGTC
TGAAGTCAAAGTCGGTGGCAACCCGGAGAGCCTCTCTCAGGTAAATGAGCATCACAGCTT
CCTAGTCATTCCTGAGAGTGGACCTCTCAAAGAGTAACTCAGCCACTCCCACCTGGTGGC
TGGCCATCTGGTGGAGATTTGTCAGGCGGTCACCTGTCTTCTTAAAGAGTTTTACCTCCT
GATGCAGGAAGTGGCTCTCCAGAAAGTCACAGAGGTAGGAATCCTTGTGTGTAGAACCCA
CAACATGCAGGTCCAGAAGAGCCTAGTTAAGGTTCTTCTCCAGAGAAGCTTCTATGTCTC
CAGGGTTCTACCCCACTCGTGTTGGGACAGCTTGTGCACAAACTAGAATCCTGTGATGTT
TTCAGACAGCAGCCTCAGAAACCCAGAGGGGCAGCTCCAGTCTGTTTCATGGAGGCACGA
AGAGTCCGAACTGACTCAATGGCAGTGAGTTGGGGAGTAAGTCAGGGACACAGTTCTATC
TGACACACACATGGGGTGGTCAAAAGCCATATTATACAAGGGGTGCACATTGTTAGAGCC
TGGAGTTTGAGGCCACTGGCTATCTGATGAACTCACAAGTGTGGGGACTGTGCTACTTGA
TATGAAAGGTTTTCACTAACACCACAAGGGTCTCTGACCCAATGAGTGGAGTATGATGCG
CGTGCGCACACACACACACACACACACACACACGGCGGCAGGGGGAGCAGTGACTCCCAA
AAACTGAATCCCTCAAAGCTATATATTTAAATTTTTCTAGAAAACAACCTTATCAACTTA
AAACTACTCTCCATTACCCTTAATACATTTGTCAAATCTGCGATTCAATTCTTGAAAATA
TTTTCCAAACTCCCCTGTTTAGATGGCTAAGGGCACCTCCTTGTCCTTTCATGTCCCTCT
GCATTCACGGAAACCAAAAGAAGTTGCACAGAATCAGGTCAGCTGACTCAGGTGCATGGG
GCAAGAGAGGCATGCTGCTTTTTGCCAAAAAATGGTGCACTGAGATGGCTGCTTGAGCAA
TTGCATTGTCGTGGTGGCAAAACCAGATGGGGATCTGTCACATATCAGGTATGTGGAGCA
CTGCTATACAATATTTTCAGAACCTCTAAACAGAAAGCTTGATTAACAGTCTGACCTGGG
GGAATGAACTACAAATACACTACAAGTCAACATTGTTGTCCCTTCACGAAGTTGATGAGC
ATCCAGAATGAGGTTTGTTATCAATTGACATTTCCTTTTTTGAAACAAGAAAACTACTTG
TACACTTGAGTTTTTCCATAGCACTGCCCTTGTAAGCTGCATTCAACATAACAACCATTT
CTATGGCATTTTTTCCAGGCCAGAAACAAAATCTCACACACTCACACTGTTCTCTTAAAT
CAACCATCACAAAAAAAATGAGGTTCAACTGAAATTGCTTTAACAAAAAACTTCCTGTGA
CCAGAAATAACCTTCCCGGGCAATACCACAGGGTGCACTATCTCAGAGCAAGTTGCTCGA
TGCTTGCCTAGCAGGACAAATGCATACAATGAAAGCTCTGCTCTGCCCAGCACAATTCCA
GTTTGAAGGGGGGGGAATGCTAGCTGGGCATCCTAGTACACATGCAAAGAATGGGTGGGA
GCTTCTCAAATGCACCACAAGGCAATTCCAGTTCCAACCAATCACAAGTCCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved