Echinops_telfairi Locus Mono:625:SNORA76
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:625:SNORA76
Echinops_telfairi
Mono:625:SNORA76
GeneScaffold_6746
SNORA76
1001..1117
2117
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGAAGCAGGAGGACAACTCCCGGTGCCACACAGTCCCC
ATGCAGTTGTGTTCTCTGCCTGACCCTGCAGTCACACCGGCCGTGGCTGGCGTCTTGAAG
GTAGCCCACCTCCCGGCCCCAGCCTGTGACTCCAGTTGTCATGTGGGACCTGTGTGTGCA
AATTCCGACTCATTCATTGGGGTCCAGGAGGATCCTTGGCTCATCAGGACAACGTGCCAC
CATGCCTGCCGGGGTCAAGAGCTCGAGTAAGCAGTGGGCTGTGCCATGGGGCGGTCACCC
TTAAGTCAGGCATTACCTCAGGATTGTCAAACGGATTTCAAAGCTTGGGGAGTAATCCTC
GTAGCGGATGATCACGGCAAAGATCATTGGCGTGAGAAAATTGGCCAGCGTGATCACAAT
CGATGGTAGGTACAGTATCAGGAGGTTCTCCCCAAAAACCATCTTGTCAATCTCCTAGGA
AGGTCACAACATGCCTTGGTCAGAAACGCAATAAGCGAAGCTGCATCCCAAATGAATTGA
ACGTAGCAGCACTCAACTGCTACACAACAGAGCCAAACACAGCTAGGAACTCAACTCAAA
CAATGGTTGATGTCAAGAAATAAATGTGAGCCACGTCCCCAAAGCCTAACATGGCAAATA
TAACTGATGCTATGGAATCGTACACTTAAAAATGACTTATCGTGCTGCCTTTAAACCTGC
CGCACCTGCCTGTGGCATGGGGGGTTAAGCTGCAGCGTCAGAGCAAGTGCTGACGCATAA
CTGGGGCTGCCAAGCCCTTTTAACCGTGAGTGACACGGCGACCCAAAAAAAAAAATACTT
AAATGGCAAAATTTTGTTCTATTTTAATACAGTAAAAAATCCGTAAGCCCCTTCTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAAATACCCATGCTGAAAAGAAA
AATAATAGAACTTTTATTGCCATTTTTTGAAATGATTGAAAGTCCTTGTTGGCAAAGAAA
TAGTGGTAAAGTAGCCCTGGGCCTGCCTAAAAGAGCAAATCTGTCTTGGAAAGACGCGTG
GCCAGAGTGCCCCTTTAGAGGCACGGACGCAAAATTTGCTCTTACATTCCTCTGCACATG
TTGGTCAGGAGATGCCAGTCGGTGGAGAGAGACACCCAGCTTGGTAAAGTAGAGGGCAGC
AAAGCAGAGGAAGGTCCTCAAGGAGACGGGATTGACCCAGGGGCTGTAACCATGGGCCCA
AACCCAGGAACAACCGGGAGGTTGGCACGGGGCCAGGCAGTGCTTCATTTTGCTGTCTAC
AGGATCGCTGTGGGTCGGAATCAACTCGATGGCACTACCACCACCACCAACATTAGAATT
ACGAAGGGCACCTATGAACATTCCGTGTATTCTGTATCAATGGGCAATTGATAAAATGCT
TTCAAGGCCCAGCGATCTGCTTCTTCGGGGGCACAGCTACGATAACCCTCTGGCGGGCAG
GTCTGCTCTTGCCCCCTATGGGGCAGGGTGACCATGAGCTGGAATGGACTTGACACCAAC
TGCTGTGATTGATTCCATTATAGAGACCCGGTGGCCCAATGGTGAAGGATCTGGCTGCTA
ACCGACAGGTTCTGGTTCAAGTCTACCCAGCAGCTTCACAGGAGAAAGACGTGGCCTTGA
GCTCCCATTAAGATCACAGCCTAGAAAATGCCGTGGGGCCCTTCCACTCTCACCCGGGGT
CACTATAAGTTGACACGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved