Echinops_telfairi Locus Poly:8:SNORD99
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Poly:8:SNORD99
Echinops_telfairi
Poly:8:SNORD99
GeneScaffold_7448
SNORA44, SNORA61, SNORD99
1001..1130, 1325..1446, 1939..2018
3018
AGGGGCGGGCCCGGGGGCTTGGTGGGAGAGCCGCCGGCCGCAGGCATAGCTTTCGGGTC
CGGAGCCCGCCGCGGCCCGGGCGCCCCAGCGCGCCCGTTGGATCGGTGAGTAATGCCAAG
GGCCCTGCGTGGGGTGGGGTGATTCAACTGGAATTAAGGGGGGGGCCACTTAAGGCCAGT
GGCCTTGACCTGCTTTTCCGACTGCTGGAATGCCCTAGGCCTTTTAAATGGCAGCGGATT
CATGGCGTTTTTAGAACTTTGTGCAGTTTGGTTTAGATGTCCTGACTGATGTCGGTAAAG
GACACAGCAGGCAAGCCGTTTGACACAGCCCCTGACACATAAACACTTGTTTCCAGCGCA
TTTTGGTGGTCTCAGACAATCCACAGGCTTCGGGCCTCCGAAGATGGCGCAGTGGGTTAA
GTCCTCCTTGCCGGCTAACTTAGAAGCCGCCGGGAAGATGGAGCTCGACTTGTGTCGGGT
CGCCATTGGAAGACGGCGAAATGGCCGTTTGGTGGGTGGGGCTATCACGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGGCCTGTTAAGACGGGCATGGGCTTGCGTGTACTGTGAGCACA
GTGAGGGCTGGGGAAAGTCATGGTCTGAAGAAGCAGCACACAGTAAAGGCCGCCTTGTGT
TGAAAGCGGAAACGTATTGTGCCTGGCCTCCAACCTTAGTCACTGAGGAGCGGTCAGGTC
ATCCAGGACTGTTGTGTTCTGTTCTTGTCACAGCTGTGCTGAAGATCCCAGGATACCTGA
AATTGGTGATCTCGGAGGAGGAAAAGTGAGACGGAGTGGAGCCATGTGCCCTGGGACCTG
GTAGGTTTCTTAACACTGATGTGGGAACTACTTGGTGGGGAGCGCATGTTCCCAAGGTCT
GTGGCTCATGTGGCCATCTGATCTCCAACTGCATGCGAGAGCAACGTGGAGAGACTTTGA
CAGCTCAGGCCAGCAAAGTATCTGCAGCTGCCACTCGCCTTTCCTATAAAATTCTCCGGG
ATCTGGACAAGAAATCCAGTTTTCCCTCAGCTTCCATGTAGGTGGGTGTATTGGATTGAT
TTGGATTTTGTACTTTTCCCCCCACTCTCCTTCAGGATTTCCTTGCTTTTCCTGGCTGTT
AAAGAAATTTGAAGATGTAGCTGTGCTGTTTAAAGGTAGGTGAGGTCAGACTCCAACTGG
TTTTTACCCTCCAGTTCCCTTTCCCATCGGATCATAATACTGGTCTGGGTGGTCGTAAAA
GGAGGAAAAGAAACACTGAAGCTGGCCCTCAGTGCTCTTGGAGCCCTTGGGCTAGTTTCA
AACAGGGGCACACTAGGTTAAATTTGCTATGGCTGCATAAATGAGGACAAACCTAGGCAG
CAGTAGCCCAGACTTATGTACTGGTGGGAGGAGTCTCATGTCTAGCTTTCTTGATTAATG
GACATGCTTGCTTGTTTTTCAGATCTGTGTAGCAAAACAGCCTGATGAAGCACAAAAGAA
TGGATTAGAGCTTCAGGTAGTAATTCTGTCTCTAAGCACTACACCAAATAGTGACAAGTC
TTGTGGAGTATTTCAAAGTATCCTCCTTTGGGGGTTAGCTGCTTATGAAACCAACTGTAA
ATGTCTTCATTGTGATTTGGACTGTAACATTTCAATTTGCTTACATTAAAGATAATCTTA
TGAATAGTTAACCACTTTGTGGGCAAAGCAGCTACCTGAATGCTAGAAGTGCTGCAGACT
AATGCCTTCTACCCACAAGTGTCAGCTAGGTTGGGTAGAAACCATGTAGTTAGCTCCCTT
TCTATAAATGCAGACTGAGCCTGGTCAAGGATGAAACCTAATCTGAGTGGACATCTCCGG
ATGATAAATGCGGATATGGGACTGAGACCAGCTGCTTGAGAAGATTGTTCCAGTGGGGGT
TAATTAGTAGTACTGACACACTGGCTCACTTTTTTCCAGCATTGAAGCACTATGGGAAGA
ACTTCAAGCAAGACATTTTATATGCAGAAAAAATTTAAATGTACCCGGCTTAATAAATAA
AAAGACTTGTGGGAGTGATGTGATGCATTGTTTTAATTTCTTGGTCCCCATCTAAATATT
CCAGGTCAAAATGGTGTTCAATCCTTAAAAGTTTTTTAGACATTTTTAGCCATTATATAC
ATATGCCATGGCTTAGACTACACCTTCTCAAAATGGCATTTAATCCTTAGATTCTTTTAG
AGAACATAATTTCCTAATTTTGCCTACACCCCCTTTCAGAAAATTACTGCCATCTTCCCA
AGGGCTTTAGACCACAGCTTCAGCTAGTGTTGTGGGTGTCTCTTTGATCGTTATTGTAAC
CCCAGGATAAGTGCCCAGCTCCCTGAAAAGATCTCAGGAATAAAAGCCAGTGTACAACTT
TTTTCAGAAGATTGATAAATCTTCCAATTCCCCTCTAGGTAGAGGGAAATTTCAGAGCTT
TAGTGTTCATGAGTATTCTGTGTTTACTATAAAAAATGTTTGAAAGCCATTTGCAGAAGA
GGTAGAAACAGCTTGGTTTGCAAACCAGGTATTAGATATGAAACAACATTGCACAAGTGG
TCATTCTCAGATTATTAAAAACTTAAAATTCATTCCAAAAAAGTATTTGCAGTTTTCTAA
AAAAGTGGTTTCTTGCACGCAGCTCATTCTTCCTGGTTCTGGCTACATCATGGCAGGGAT
CTCAGAGGACACTGTGTCCAGGGGCTGCCAGTGACAGTCCATTAGTGCATCATATAGTTC
CTCACTCTGCTCCATGAACTCCTTGTTGGCCTCTGTCACGTCCAGTTGTGGCGTGGGGTC
TAGAAGGAAGCAGGGACAGGTTCAGGACACCAGACAGGTTAAGGCTAGGGGCAGACATCA
GATTTGGGATCTACTGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved