Echinops_telfairi Locus Mono:524:SNORD95
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:524:SNORD95
Echinops_telfairi
Mono:524:SNORD95
GeneScaffold_9119
SNORD95
1001..1067
2067
GTATAATTCCCCTTTTATTTTGCACAGAGAACTGCGATCATTCCGATCCGCTTTCCTTA
GACGTCCTCTGTCATGAAACATTTTTAGGCTTTGAGTTCAACTAAGCATGGTTTGAAAAC
CTGTTTTAAGTCTCTTTGGGACAGTTCGTTTTTTAATTGCCCACGAGTACTCACAGGTCC
AACCTCGAATCTGGCTCCCCTTCCAGGGCCCGCGGAACTGCGAAGTGGAAGGGGCGGGCG
CCCGTCGCGCCGCGTACCGGAAGGAGAAGCCGTCCGGGTAGCCTTACGGGAAAGTGTGCC
GTAAGCTTTGGAAGCAGAAAAGTCCCATCCACGTTCGAATACACTTTTCAACACTCGGTC
CAGAATGTGGTGCTTTCAAATTACACTGCGTTTCAGAAGGGAAACTGCCCTGAAAAGTAA
CCTACAGCTTGTACCCTATGCACCCACCCGCTTTCGCACAAGTGAAGCCTAGGGGCCGCT
CTTCAGCGCCGGAGGAGACGGCACTTCCGGTTCCGGCGGTGGAGGGGGCGGAGCAGGTAT
TTCAGGTTCCGGCAGCGGCGACTCGGTCTTTTTCTCCGGTGAAGAGCCGCGCGAGGTGGT
GTGTCGGAGCTATCCGGTGCCATCCTTGTCGCTGCGGCGACCCCCGCACCTGCCGCCGCC
ATGACTGAGCAGATGACCCTTCGTGGCACCCTCAAGGGCCACAACGGCTGGGTAACGCAG
ATCGCTACCACGCCACAGTTCCCCGACATGATACTGTCTGCCTCGCGAGGTACGTGGTGG
ATTACAGGGCTGGAGGAGGGGTGCACGCGCTGTGCTGGGCGGGTGGCGCGTGACCCGCAG
GCCCAATAGACAAACCACATATGAGTGCGCCCATGGGGACTCCCATAAACTTGTAAGGTG
CCCCTTTTGGCCCGTGAGGCTTCCGGGACCAGGCACAGGCCATGGATGTCAGAAGTGTGG
GACCTTTAGCTGTATTGTACCCGGAAGCCTACGGCCTGGCGGAGCGGTGATGATTTCAAC
ATGCCATCTGAGCATCCGTGCTGAGACCCAGAGGCTGTTTCTGAGCTACCGCCCTTCCCT
CATTCTGGGGAGTAGGTATTGGCGAACTCTAGACACTCCGTGATATCCTGGCCTCCTCTC
CACTCCCTGAGGTCGCCTGCCTTGTTGCTTCCACACTGCTAAGTTTTCTATGTCTAACAT
CATGGCCGACCTGTAACTATAAAGTTGTGTGAGTCACAAAGAGAATTACTTTGGGCACTC
CAAAGTGCTAGTACTGCAGCTCGTCTGGTCTCACCCAAACTGCAGTGTCCACGTTACACC
TCAGGTGTACTTGAAATCGTTGTTCAGTTTATCTCCAATCATAAGATACCTAGAGTTGGG
AGCAAATTTGTGCGCACCTGATTTAAACTTTTTCTATTTAAAAATTATAGTTCAGTTACA
GTTGAGGCCATGCTGAATCAATTTGCCCTGATAGGTAACTGATAGTTGCTTTTCTCTCAT
CTTCTACCTCGTAATCCCATCAGTGAGCTTGAACTTTTGCATTGTCCAGTAGGTTAGTAA
GGGATCTTGAAAGGTGGGTGTCTAGATACTCATGGCAGCGGGTAGCAGCGTTCTCAGTGG
GTTTCCATTTCTGCTTATCCTTCCTTAGATAAGACCATCATCATGAGGAAGCTCACGAGG
GATGAGACCAACTATGGCATTCCCCAACGTGCTCTGCGTGGTCACTCTCACTTTGTGAGT
GACGTGGTCATCTCTTCTGATGGCCAGTTTGCGCTCTCAGGCTCCTGGGATGGAACACTA
CGTCTCTGGGATCTGACAACGTAAGTACCTGCTTATTCTTGGCTTTGGGGCTTTGAGGGG
AAAGCTGGGTAGAAAAGGGGCTGACTGCTGCAATGGCTGAGTCCTGGCTTGAATCGATGG
GGTTACAAAAACTAGGGAGCAGTCCAAAGGAACTGTTTGACTGGATCTCTCATCCAGTCA
GGTACCTAAAAGTTTGAAAATGGTTGCCTTGAGAGCTAGCTCTGCCTTGCATGGTGGTCT
GGCAAGTGACAGGATCCTAGTGATGACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved