Echinops_telfairi Locus Mono:210:SNORA66
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:210:SNORA66
Echinops_telfairi
Mono:210:SNORA66
scaffold_32219
SNORA66
1001..1133
2133
TCACCTTGCGAGCTGCCCCCACACATCCTCTTGGGAGCCACTGTTAGAATTAAGCTCTG
CCCTTTGGATTGTAGCTACAAATGTAAGACTCGGCCCCCAGGTACGGTCCATTCCAAACA
AGTCATTTTTATTGCATGTGATCTTGTGTAAAAGATGGATGAGTGATCGGTCCTTTGACT
TAGCTGACAGTTGTGCAAGGCTTTTTGTGCCCTTTGTGGTCAAAGCTTGCTGAGGTCAAG
ATGTTTGCTAAAAATGTGTGAAGCATGTGAAACGCCAACTGAAGTCGCTGTCACACCAAT
GGTTGTTCCACGGTCCTGTTCCGCAGGCTGTGGACTTCAGGCAGTTTCTTCCTTCCTTGA
GGGTGCAGTTAAAGGTCTTCCCTCCCTTGGTTTACCTTTGAGAGCCTGCCCATATTCCCT
CCAATGCTTGGCCAACTGAACACTGCTGCTTTGTATGGGACACCGTCCCCTAAACTTGTA
ACATTTAAATGATATAGAAAGTTGTGCACTTGAGTGAGGTTAGCACACTGATCATGTATG
ATTGCACCCTGATCATGTATGAGACAATAGCAGCCTGATCATGATGAGACAAAATGTATC
ATATATATTTAAGACATCTTAATGATACCAAGATATGTGTATTGCACAGAGAACTTGTCT
GAAGCCATGTAAGCTCATGGAAGAATTCCACTGTCTTTTAATTCCAATTTCCACAAACTT
TTTGAAATCTATCTATATAATATACACACACACATACAGATTTGTAATTATCAACTTTGC
TTTTTCACAAACAGAAAATCTCACCATTTCAATTCAGGATCCAACTGAATATTGGTTCTC
TCTCCCTTAAGTATATATTATGGTTATATTTAAATAATCCAAAGAAGATGTTCATTAACA
AGAAGAGACTAGTGAACTTGAAAGTTATCATATATGAAATTCAAAATCTTATTACACTTT
ATTTCCTCAGACAGAATGAATTCATAGAAAAGAAGCAAATGTTGCAAACTCGATCACTAG
CTCTCCATGATGTTGCAGAAGCAAGGGGAACCAGGTTTGCTAAAGTAATTGTGGGGATAG
TAATGGCTTAGCCTCAGGGACTACTGAGGTAGCCCATTCTTTCCTACTGCAGTGAAAAAA
AAAAGAGAAAGCAAAGGTAGATACCATACAAAAACTCTAATAAATAGCAATATTTGAATA
TCATTTAGGAAGCTGCTCTCAGGCCAAATAGTTCTCATAGATAAAATATTTATTGACAGA
AGGCTGACTGAGTTAGTTATTGTGTCAACCTGGCCGATAAACACATGTGGGGTTAATTGA
AGGGCAGAGAGATAAATGGCTCGGTGAACCTCGCCTTTCTAGTTCTCGGGTCTCTTGCTT
TCTGGTGGTCGGACCAGTGTACAGCTGCCTTAGCCAGTTCCCTGTTTCAGCTGACAAGGC
TCAGTTCCTGCAAGACATCCCTGAGGAGAAGCCACAGGGACCTACCCCAATGCAGCCCTG
GGTGCTGGAGCAGCCATGTGGAGACCCCTGCCAGCATTCAGATGCTTACACACTCACTGA
CTCGGCTTTTGTTCTGCAGTCGGCATCATTGTGTCTGTTTTGTGAGATGGAGGAGGACTT
TGTGGATTGGCGTTGGACATATGGGTTACTGTTGGCCTTGTGGTCTTGGGCAGCACTGGG
TTGGGGTGTTTTCTTGATGTGCACTTACCCTTTATATAAAACTCTCTCTTATACATGAGT
TTCTGTGGATTTGTTTCTCTAAAGTACCCAGACTAATACACTGACTAATGATTAACTTTC
ATCCAGGACCCTTGGTGGTGTCGTGCAGACTGCTAATTGCAAACTCAGCAGTTGAAAATC
ACCAGGCAGTCCACAGGAAAACGAAGAGGCTTTCTCCTCTTTACTGATTCACTGACTCAG
AACCCAGAGACAGTTCTCTGCTCTGCAGGGTTGTTCTGAGTTGGAGTCCGCTTGATGGCA
GTGAGCTTGGCTTTCGGTTCTGCCTAACTTCCATTACCAGTATGTGACTGACAGTCTCTA
AAAATAATGACTTGTCACACCATGGTAGCTTGGGTGCCATCAAGTTGGCTAGTTCTCATA
GTGGCCTTATGTGCAACAGAACAAAATGCTGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved