Echinops_telfairi Locus Mono:476:SNORA19
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:476:SNORA19
Echinops_telfairi
Mono:476:SNORA19
scaffold_175421
SNORA19
1001..1130
1132
AGGATTGCGACTTGGGCTGCTAACCATGGGCTTAGCCATTTACAACCACCAGCCTCCCT
GACAGGAGATGGACGGGCTCTCTACACCCGTACAGAATTAGTCTTGGAACCCGAGACCCT
TCTCCTACGCTGTTCTGCAGGCCCCTTGGAGTCAGAACGGACTCGATGGCAGTGCACTTG
GTTTGGGTTTTGGTGGGAAAGCTGTGAGTGAGAGGAAAAGGTGGCAGTTGACTTCCTTAC
AGATGGACAGCCTTGGAAACCCTCTGATGTCGTTCTTTGTCCTGTGGAGTCCCTGTGAGT
TGCTACAGCAGTGGGTATAAGCGGTGGTCAGTTAAGCCAGTTAAAAACCTCCTTACAGGA
ACAAACTCAAAACCATCAAAAAGGCCAGCCTTGCTGGTCAAATAAGGACAGGTGGACCCT
CTGAGCTGTGGCCCTTAGCCACTCGTTCAGTCTGGATGGAACATACCCTGCTCCCATGAC
TCAATGTCTAGTTACTAGAAAACCAATGGACTGCCATTGAACGGATTCTGATACATAGTA
ACTGTATAGGACAAGGTTGACCTTTTGAGTTTGTGAGACTTTAATCTTTATGGGAGCAGA
TAGCCCCATCTTTCTCCAGAAGAGCTGCTGGTGGGTTCGAACCATGGCCCTGTGGTGAGC
AGTTCAGTGTTAGCAGCCCACTATGCAACAAGGTCTTGGGAAGAATACCACTAATGAGGT
ATGCATACCTTAGAAGAATCGACCCTTTGCGACTGAAAGGGCAGCATTGATGCCAGGACA
AAGTTCTGAAGAGGGGCCAGGAGGAAGGGAAGTGGGTTAGAGGTGCTGCATTGAGGCATT
GCAATGAGTGGAACAAAATGGGTATGGATTGTTGAATGTAAAACTGATGATCTGTTCTGT
AAACCTTCATCAAATTCACAATAAAAAAAAAAAAGACTTCCCACAGGAAAACTCCATTTG
GCTTTATTAGTGGAAATTGCCGGTCTTTAAAGATTATTCCAGTGCACATTTCATCGACGT
GCTACCATTTGTATGTGAGCAGTGTTATTTCTTATGTGCGAATCGAGTAGCTGAAGGTCA
ATTAGCAGTTTAACTAAATGTAGTAATGCTGTCGGTCTCATTCATACAAAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved