Echinops_telfairi Locus Mono:300:SNORD113
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:300:SNORD113
Echinops_telfairi
Mono:300:SNORD113
scaffold_324868
SNORD113
1001..1077
2077
GGAGACGTCGCACAGGGCAAGATATGACAAAATAATAATTTATAAATTATCAAGGGTTC
ATGAGGGAGGTGAACAAATGAGGAGCTGATGCCAGGGGCTTAAGTGGAGAGGAAATGTTT
TGAGAATGATGAGGGCAATGAATGTACAAATGTGCCTTACACAATTGATGTAGGGACGAA
TTGTGATAAGAGTTGTAGGAGCCCCGAATAAAACGATAAAAAGAAAAAATCTGCTTTTCA
CTTGGCAGAGTGGATACACCATCATGGGTTTCATTGGCATCTGTTGGCGAAGACCCTGCC
GCACCCCCAGCCCCTGCTCCCTCTAGGGGTAAGGAGAAAAAGAGGCATGTAAGTAAAACT
CTAAGTTCACCTTATTCCTGGTGGGGTTGGGCTTGTGGATGAGTCTAGGGAATTGCTCCC
AATAATCAAATAGCTCCCCTTGCAATCAAGTCAGAGCTGGTCACGGGGCGACCAGTGCCG
GACGTGCTTCTTGCAGCATAGCGGGTCTCTGCAGGACGGAGGCTCTTTAGTCCCTCTCGC
GCTGGCGAGCCGTCCATCTGAGCTGTGCGCCACGTGGATTGAAACAACCTCTCTCCACCG
TATTGTTGTAGACTGTCAACCCATTCAGGGGTCAACTCAACGACTTTGAATTCAGACCAG
GGGAGGCCATGTTTTCACCTTCGTTGTGGTGGGAGACGAACATCTCCCACTTGCTCGTGC
TACCACCTGTCACACATTGACACGCCCCTTGGCCCATCCTTGCACTCACTGTGCTGCGAG
GACACTCACAGCTTCATGTGAGCCCCGGAGGACTTTGCCCAACGAGGGGCACGTCTGTGG
GAAGGGATCTCTCACAGGTATATTCAGATCTTCAGGGATCTGACAAAGAATGCCCCCCCC
CTTTCTTCCAAGTTCATAGACATTGGGTCATTTTCGTATTACTGAACCCAGGAAGAAGTC
AAGAACTGCATGATTGAATAAAGGGCATAGCGTACGGAACATGGATCGATGATGAGTACG
TGTGGGGCATCTGAATAGGACATTTTGATTAAACCCTAACTGTAACTCTGAGGTCCATTG
TTAATAGGGACCGAGGGCTGACACCTGTGGGAAAAGTTATGAGCTATTCCAATATCATGC
TTGTAGGGTGTTATTGCTCATGAATATGGGTTGTATTATCATATCTCAATGGATGCANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGCCCTCATTCTTTCTCCTGTGGAAGGGCTA
GTGGTTTCAAACCTTCGTTCTCTGCATTTCCTTAAGTCAACATCAGCCCACATTTCAAGT
CGCGTGTAGCCCAGCGGCCACCCGGATTGGGACAGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved