Echinops_telfairi Locus Mono:358:SNORA74
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:358:SNORA74
Echinops_telfairi
Mono:358:SNORA74
scaffold_267194
SNORA74
1001..1197
1430
NNNNNNNNNNNAAGATAAGACAAAATAAACCTAAATATAAGTTATCAAGGGGGGGCAAG
CAAGAGGGGAGCAGGAAGGGAGGGGAAAATGAGGAGCTGATGCCAAGGGCTCAAGTAGAA
AGTAAGTGTTTTGAGAATGACGAGGGCAACAAATGTACAAATGTGCTTGACATACAATGA
ATAGATGGATGGATTGTGATAAAAGTTGTACAAGCCCCCAATAAAATGATTTAAAAAAAA
AAAAGATAATCTAGGAAGGGCTTGAAAACTATGGCCTACCACATGCATTTGTAAAGGAAA
AGATATATTTATATTGGAAAGCAAAAACAAGAAAATGATGTCAACATATGTACAATTGTG
CTTGACACAATGGATATATATATATGGATTGTGATAAGAGCCATGCAAGCCTCCAATGAT
TTAAAAAACAACAACCAAATAACAAGTAAGACTAAAAATAAAACAGATTTTTAAACCCTT
AATTGAAAAGAGAGAAAATATTAAAAACTAGGACAAATTTAAATAAATCATAAGGAAGAG
TAACATAGATTGCTAAATTCTAACTTAACTGCATCTGCAACCATCCACTTCCCCATGCAG
TCTGCATGTGAGCAGGGCTAGTCACATCCCAGGTCCATGGTCCGAGGGGATTTCCCCAGG
CACTTAATTCACATGTATTTCCCCTCCACGTTTTTTTTTTTTTTTTTTACTGAAACAGCT
TTAAGCCTTCCTGTTCTTTTGAACCACCACGATCAATTTGTCGTCCTATAACGGCTTGTG
TGTTGTTGTGATTCTGGAAGCTGTGTCACTGGTATTTCAAGCGCCGCAGTGAATACGTTT
CAGCAGAGCTTCCAAAGGAACAACAGGCTATGAAGAAGAAATAGGCTATCCAGTCCCGAT
GAATGAGCCACTGAAAATCTCATGAACAGAATCAAAGCATTATCAGACTAAAAGCATCAT
GAGAAGAAGCAGAACTTTGTCTAATGAAATGTTTCTTGCCGCCCAATGGTTGTCAGCTAT
CCGGCTAGCACGATGCCTGTGATGGTGTTACACTGTTGGAGGAGCAAGCGCTGCCCAGTG
GGGTCTGCTCCAAGCACTCTTTCCGTGTCGTAGTCCCGTCCCTTTGGGCAGCGTTTTGCA
CCTGTGAAGCTGGAATGGCTCCTCCTGTGGAGTTGGTGCTAGTCTGGATGCAAACATTAA
AGAAACGTTTCTCGTCAAATGAAATGCTTCCGGTCTGTGCCAGGAAATTTGGAGGACAGC
TGCCAGAAGTGCACGCCTGACTCAGAAGAGGAGGTGGAACAAGGGCTATCACTGCTGATG
TCAGAGGGATCTTGGCTCAACACAGAGAACACTAGAAATATGTTCACTTGTGTTTTATTG
ACTATACTAAGGCATGCAGCTGGGCGGACCATCACAAACTACAGACAGCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved