Echinops_telfairi Locus Mono:149:SNORA44
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:149:SNORA44
Echinops_telfairi
Mono:149:SNORA44
scaffold_281353
SNORA44
1001..1122
2122
TAAAACTTAGGGCTTCAAATGGCAATTATTTATTAGCTCATGACTCTAGATGCTACATT
TTGGACTGGACTAAGCCAGATGACTCTTAGCTGACACCTGTTGGGCTCATTCATGCAGTT
GGAGTCTGTTAGCTGGACCGAGACTGGGTGGTCTGGTCTGGCCTGAGTTGACTTAGCACA
TACTGAATGTCTATCAGGTGCCAGGCGCTTGGGAAAACACCAATGTGGATAAAATTGCTT
ACTGTGCTCCTGCCTTGTGTTAAACTGATGTCTGAAATGTTCAGTGCATTATCTCATTTA
ATTTTCCAACTTTCCTGATCCGATCATTGTAATGATCACTCCTGTTTTATAGATGAGGAA
ACTGAGGCTCAGAGAGGAGGGATGACTTATAATAAGACTGGAGTCAAGAACCATTTAAGA
TGGAAGTCCAGAACCCTCGAGTATTTGCACAGCCCACACCCTGGCACCGCATCATCCCGA
GCCAGCCCGCACTGAAGAGCACCATGTGCCCTTACCCTGCGGACAGTGTTGCCAAGGGGA
CAGAGCCAACACAAAAGCTGATAGTGGCAGCCCAGTGCCATTCATTAGCGAATGGTCCTC
GGGCCTGTTTTGCGTTAGACATTATGTTGGGAACTATTGTCATGGTGGTTCGTTGTGCTC
AGATCACTCCAGCTCATAGCAACCGTGTCCAACAGACTGAAACACTGCCCAGCCCTGCGC
CACCCTCACGGTTGTTGTTTGAGCCCACTGCTGCAGCCACGGTGTCGGTCCACCTCCTGG
AAGGTCTCCTTTTGTTCACAGCCCTCTCTACTTTATCAAGCATGATGCCCTTTCCCAGGG
ACTGGCCTCTCCTAAGAACATGTCCAAAGTATGTAAGACAGCGGTTCTCAACCTGTGGGT
CGCGACCCCTTTGGGGTCGAACGATCTTTTCGCTGGGGTCACCTGATTCATAGCAGTAGC
AAACTTACAGTTACGAAGTAGCAGCGAAAATAATGTTATGAGAGCATGTTCCCAAGATGG
TGTGGCCATCCGAGCTCCAACTGCATGCAAGAACAACCTGGAGAGACTGTGACAGCTCAG
GTCAGCAAAGGATCTGCGGCTGCCACTCCCCTTTCCTACACAGTTCTCCAGGACTGGACA
AGGAAGCCTCCTACCGAAGTCCAGTTTTCCATCAGCTTCCCTGTACATCTATGGCTAGTA
AAAAAGCCTTGAGATGTGATGACGTGCAAAAGATCTAGAGTTTTGAGCACTAAGCACGAT
GGGAAGAAAGAACTTCAAGCAGGCCGTTTTGTATGCAGCAGAAAATTATTAAAATATACC
TGGCTTAATAAATAAAAAGACTTGTCGCGGGAGGGGGAGGGCGAATAATGTTATGGTTGG
GGGTGACCACCACATGAGGAACTGTATGAAAGGGTCGCGGCATGAGGAAGGTTGAGCACC
ACTGTGAGGAAGTCTCGCCATCCTTGCTTCTAAGGACAATCTCGTTGTGCTTCTTCCACA
CAGCTTTGGGTTTCCTTCCGGCAGCCCTTGGCACTTTGAATAGTCTTCATTCTAGTCCTC
CAAGTGACAGCCTTGCTCTCCCCGCCTCTCAAGAGGCCTGGGGCAGCAGCAGTACCCAGT
GTACCCAGTGCAGTGCGTTGTTGGATCTGTTGACTGCCGCTTCCGTGGGTGTTGAATTTG
GATCCAAGACAGATGAAGTCCTTGACAATTTCAATCTTTTCTCCATTGATCGTGATGCTA
CCTATTGATTCAGTTGTGAGGATTTCGGTTTTCTTTACATTGAGTTGTAATCCATACTGA
AGACTGCAGTTTTTAATCTCCATCAGCAAATGCTTCAGATTAGCCTCACTTTCAGCAAGC
AAGGTTGCATCATCTGCATCTAGCAGGTTGTTAATAAGCCTTTCCCCAGTCCTGACCTTG
GGTTCCTCTTCAGATAGTCCAGCTTCTTGGATGATTTTCTCAGCATACAGATTGACTAAA
TATGGCGAAAGGATGCAACCCTGGTGCACACCTTTGCTGATTTAAAACCACGGAACGAGT
TAGGGGCGTGGAAGTGAGTCAGGCCCAGGATCCAGCAACAGCAACATAGAGGAGGAAGTG
ATTAATCTTGCCCGGCTTGGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved