Echinops_telfairi Locus Mono:29:SNORA32
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:29:SNORA32
Echinops_telfairi
Mono:29:SNORA32
scaffold_291269
SNORA32
1001..1121
2121
ATAACCCAATCCTAAAAAAGTAAGCCTCTTTCTTTCTCAGGTTTCATCACCTTTCCTGA
GCAGTTAGGATCTCTCCCCTACCAATGCAGGGGGATTTCACCAACTCCATCCTTTTCTCG
TGTGTGTATGTGGGGGGGCGGGGGGTACGGGAGAGGGGGCTGCTTCTTCCACCAAAAGAA
AGGCCTTTAGTACTTAACATGCATGGCCATTTTCCTCCCACTCACTTATCTGAGGCATAG
AGATGAAGGAAGAAGCATTCATCTGATTAATGAACAAAGAGCCAATGTTTTCCCTGCTCT
ATCTCTCCCTTGTCCCTTTCCCCTGGAGAGAGTGGTCTCCAGGGAACAGACATCATCCTC
TGCTGGCCCAGGCCAAAATGGTTGCACACATAGCCCATGACTGGCACGATAAGACGGCTA
GTTTCTTGGGTTCTGAATAAGATGTCCACTTTCCTGAAGTGGATGTCTTATGCTGCACAC
TTTATTCTGCGCAGTCACCTTTATTAGGAATAAAAACATCCATTGTCATCCCTCCACGAT
CTTAGTCTTCAACTGTTTCTGAACCTAGGTGGGCAAGAGGAGTACTTCTCCCAGATCTAC
ATCCTGTCTCCTTAAGCAGTTTCTGCTCTCATGCTCATTTTAAACTGAATGTGATGGTCT
TTCAAATTCTATTATTATAACCAACAGAAAATTATTTCTCTTTTCTTTGAGCATGCAGAA
AGTTTCATCTTCAAACACTACCAAGAAGAGAAAGGCAGCACATTCCAGATTCAATAGTAG
AATCCTCACCTTCCACCTGGGGTGCTGTCACCACCTGTCTATCAGTGGGGGCTTGACTGT
CGCTGTGATGTTGAACAGGTCTCATGGGAGCTTCTAGGGGGAAGTATAGTAGTAAAGACC
TGATCATCTACTTCTTAACATTCATCAAAAATGAATCTTAAGAATTGCAATAGCACATTG
TGGTCCAACTCACCTTCTTTGGACGGGTCAGGAGGAAGGATCAGTCACTGTAGGAGGACA
TCGTGTGTGGGATCTGGTTTACTGTGGACATGGCCATCGACAATTTCCCAGGAGGTTTTT
GTCTTTGCTACCTTGCTAGCATATCACTAATTGGGGACATTGCTGAGATCTACACTCATA
GAAATATTAAAGCTGTACATTTTCTAGAACCTTCGTCTTATACACAGTAAAAGTTTGTTT
CTGTGCTACATTTTCAAGATCTGAAATTAATGCCTACTGAACAGTATCTTGACAATGGTG
GATTTTAGCATGGGCTTCTGAAAAAGGGCTATCTTGAAGATAAACTTTTACAAGATTCAG
AGGAATTAAATAGTATTCTATGAATGACAGATAAAAGACATAAAAGTCTTTAAATAAAAT
GTGTTCACATTAAATAAAATTTATAAAATAAAAACTTTTGTAATGTAGAAAAAAAAGAAG
ACATCATTTTGGTGAAGTTGAGGGTCAGTGGGGTTGTATGAGACCATTGCTGAAATGGAT
TGTCACAATAGCCAAAATGACAGAGCCGAACATGGCTGTGATGTTGGGGATGACACCGGC
CCAGCCAACCTTCTGTGGTAGATCAGCCCCAGGGCAGCTCGCAATGACATTTTCCATTGC
ACTCACCTTGCTTGCTTGCTTTCCTTCATGTGTGCTACAACTCAATGCTATAATTTGGAT
TCCACCTTTCTCGGGCACTTTTCCTCTGAAGGGTGTGCTTTAAGTGTATGAGGCCTCGGG
GTTCGATCTCCAGCATCTCCACAAAAAAAAAAAAAAAAAAGAAAATATTGTTTTCTGCTG
TCCTTAAATCATAGCATTTATGTGTTAACCACTTTACTTGTGATAGGCTGTTATGGTAGA
GTCTTACCAAAAGCAAAATTACCCAACTGCCAGGCATAAAGTGTTGCATTAATTTCCCAG
GCTTTGAAAAAGTGTGTTCCAAGTTTTGGGTTTTTTTTTAAGAAATCATCTTTGCTAAGT
GATCAATTCCCTGACCATCATAGGCTTTAAAATTCAAACTAGATCTATTTAATCAATGAA
CAAGGAATAGCCCATAGAACTTCCCCCAGACACATTGGGGAGGGCTATATAGCCGTTTGT
ATGGTATGCTAAAATAAACTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved