Echinops_telfairi Locus Mono:373:SNORD22
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:373:SNORD22
Echinops_telfairi
Mono:373:SNORD22
scaffold_199116
SNORD22
1001..1123
2123
TGTGAATTAGAATTTTGTTAGCACCAACATGTAGCTCTTGTTTACCATATTCTAGTCTT
ACTACATGCTTTCTTCAGATATATATCTATGTATATATATGTTTTTAAAAAAATTCCTCA
GCCATGGCAATTTCTAACCTCTATAAAAATCCTTTATATGAGAAGATAGTTTTCAATAAA
TAAGATGAACCTGTGTAACTTAATTAAATCATAATGTACACGGGTCTGAAAGCTGTGATC
TGCCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNATGTGCTCTTTGTCTGTGTGAATATGTGTGTTGGTAAAAACAAGTGAGATGT
TGAGTTGCCAGGAACCAGAATGTGTTGGGCTCTATTGTTTCTTGAGGTGATCTAAATTAG
TGTGTCCTGAATTGCTTCTGATGGATTAAAGGAAGGTGAATATAAGAGGAGGGCCATCAA
CTAGAATTCCAAGATGTCTATACACTTATAGAAAGGGGGTTCCCCAATGAGGAAACAATC
ATGTCTTACCTCCTGTCCTAGCCCAGACCCTGAAAAGGCGAACCCACTGGGGCTGGCTTG
GGGAGGAGAGGAGAACTTGTTCCAGAAGGAACTGTCTGACGGAGTCATAGGATCCATACA
CACGGGCCAGGGGAGAGGGGAGAACACCACCCAATGGAAAACAAACTGTTTCAGGGGAGG
AGGAGGAGTTCTTGGAGGAGAGGAAGGACAAGCTAACTTTAACCAGAACCAACTCTTGCT
TGCTGTCCAGAAACACAGAAATGACTAGCGTCTGTTTGTCTAAATAAAGCCTTGCTTTTC
TCTAAAAAAAAAAAATGGGGGTAATACAGTATTAATATTCAGAAGTAGAAGGAAAACAGA
TTGTCTCAAGCAAAGAGTGGAGTGATTGCATCTCTAGCTAGTTGAGTGTTGAGGTGAAAC
ACTTTGGCTCGTGCAGTGCAAAGGTCCTGTTCACTGGGTGTTGGCCTCAGGTGTGGCAAA
GTACTTCGCTGTTTCTCTGCTGTTCTTATAAGCGACGAGATAACTTGGTTTCATTATTTG
TTACTGGAATATATTGAGCTTAAAAGCCTCTGCGATTGGGCATTCATGCTTTATTCCCAT
CAAAGATGATGGTGGTTAAGTTTAGAAATCCTTCCATAACACTGCCTGGATCAGAGCAGG
TACTCAAGAGATATATGTATATATATATATACACACACACACTAATTAAATGAATAAAAT
ATAATTTAATATTAGATCATCAATATAGCACAATTTAATCTGGGTTTCCTTTCATTAACA
TCACAAAAGAACTTATTGTTAGGTGCCAACAAGTTGTCTCCAACTCACAGTGATGCTATG
TATAAGAGAATGAGTACCACCTAGCCGCCCTTCATCCTCACAATCATTGCTAAGTTTGAG
ACTATTGGTGCAGCCTCTCTGTCCTCCCCTCACCTGGAGGCTCCTCCTTTTTTTATTTTT
TAATTCCTCTACTTTATCAATTATGATGTTTTACTTCAGGGACTGGAGCTTCCTGACATG
CCCAAATTAAATGAGTTGAAGTCTCCCCATTCTCAATTTTAAGGAGCATTCTGTTTGTAC
TTCTTCCAAGCTACATCTGCTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved