Echinops_telfairi Locus Mono:124:SNORA25
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:124:SNORA25
Echinops_telfairi
Mono:124:SNORA25
scaffold_315577
SNORA25
1001..1124
2124
TGTATACACACACAGTCATGGAACATTCCATTACCTTTTCATTCCATTTTTTTTCCTAC
AAGCTTTCTGAGGGAGACTGGCATATATTTTGCAGGATCAAAAGCAAAAGATAATTAAAT
GTTTTAAGTACTTTGTACCACCTGGAACAAATAAGAACTGTTCCTTGTCTTAAAGTAACT
ATCACTTAGATGAAAGCTAAAGTTTACATCCAGACTGTAGCCCATTAGCAGTTGCCATCC
CAATGGATCCTAAATAGCATGTATGATCTCATCCACTCAGGACAAACTAACATCCTTCTT
AGAAACATCTTTGGTGACAGCATCTCTGGAATGTCTACTCCTAGCACAAGTAAAGCAACA
TCCGCAGTCTGCAAAATCCTCCTCAGAAGTATGCTGTTTAGAAGCAGAATGACAATGAGT
AATGGTAAGAAATGGGGCTCTGCCCCTGTGGGAATGCAGCAGCAGAGGTAGCAAAATACT
TAAACTTCCAACTGCTTTTCCTAGAGATTTAAACACCAGCAAATTAGGCCCAGTAGGCAT
ATAAAAGATAAGAGCCCGCTTAACTCCCCTTTCACCTGTTCAGCTGATGCAGGGGTCATT
TCCCTCTGAGTAATTTAACATTTGTTCCACTTCTGACCTACAATTAGGCAGTTCCAGGAG
CTTTGGTGGCACAGCTGTTAAGAGCTTGGCTGGTAATTACAGTCTATGGTTCTACCCCTC
CAGCTGCTGCACGGGAGAAAGATGTGGCAGTCTGCTTCTGTACAGATTATTATCTTTGGG
TCTACTCTATCCTGTTCGGTCACTGTGAATAGAAAAGGAATAGAAGGAAATATACAGTTG
GGCTGCTAACTGCCAATGGCAGCAGTTCAAAATCACCAGCCACTCCATGGAAGAAAGGTC
AGATCTCTACTCTCATTTTTGTTTCTGCTTTTTCGAGATCTGAGATTAATGCCTACTGGA
CAATGGTGGCTCCTTACAAAGGTGAGCACACTTGTAAAGTCAGGTCATTTCAAAGCGGGC
TTGTGGAACTGAGACCAAGAGCTCTTAACGCCGTGACCACAGATAGTCTCCACGGAATGC
CATCGTCCTCCACAGTGCTATGTTTTCTCCCGTGGAGATACATGGTTACATTCAGGAGTT
TATAAAAACACGTGCCAAGTTCAACCAAGGGGTAATTTCTTTCTTACCAGGGCTATCTTG
AAGATGAACTTTTACAAGATTTAGAGGAACCAATGGATGACAAAGATATGTAAAACTCCT
TAAATAAAATTTATTAACATTAAATAAAATCTATAAAACAAACAAACCAAAAAAAGAGGT
GCAATCTCAGCCAACCCCACAGGATAGACTAGATGGTAGTGAGCTGGGGGTGTGGGGGGA
AGGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved