Echinops_telfairi Locus Mono:306:SNORA2
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:306:SNORA2
Echinops_telfairi
Mono:306:SNORA2
scaffold_306478
SNORA2
1001..1144
2144
CAGCTCCATGCTTGACTGTGGGTGTTAGGCTGCTATTAACTTTGAAGAACCTCAGTTCC
TTACATTTAAAATTAGGTTGATACAAATTTTCCCCCCATGGGGTTGTACTATGGACCGAA
AAAGAGAATGTGATATGCATAGAGTGAAGCTGTCTACAAATGTTATCTCTTCTTCTGTTT
GGAGATGAACCGAGCTTCCCTAGAACTCTGAAACACCATGCAGTCACAGTAGAACACTTC
CCATCAGGAGGAGCGGGAGTAGGCTTGTGTCCAGGATTGGACACAATAGTATTGAGACCA
TCAGGAGTTGTTGCTGTACAGTTGTAGTTCTTTCTTCTTGAGCCACCATTTGTGTATACC
CTGACCGATCCCTTTCCTGGGGAGACTGGAGGTAGCGGGCTTCTGAAACACCAGGACTTG
GGTTTCTAGTAGAACACTATCTTAAAAAGCAAGAAGAGAGGAGATGAAGAAGATAATGAG
GCAACAGGAATATGGTATATTATTATCTTTTATTTATGTTTTCTTTAATATATCTGAGGA
GCCCTGGTGGCATAGGGGTTACACGTTGGGATGCCAACTGCAAGGTCAGCAGTTCAAAAC
CACCAGCCACTCCTTGGGAAAAAGGCAGGGCTTTCTACTCCCCTAAGGAGTGACAGTCCT
GGAAACCCACAGGGACAGTTCTACCCTGTCCCACAGGATTGCTGTAAGCAGGCATCAACT
TGATAGCTATGAGTTTGGATAGTTTAATATCTCTGAATAAAGGGTCAGTCTTCTCCCTAC
AGATAAAACATATCTGTTGTTAGCTTTATTCATAGATACTCGATTTTTTAATATATTGTA
AGTTGCAACTACCGTTTGTCCGTTTGTCATATTGTGGCGGCTTGTGTGTTGCTGTGCTGC
TGGAAGCTCTGTCACTGGTATTTTCAAATACCGGCAGGGTTACCAAAAGTGACCAGATTT
CAGCAGAGCTTCCAGACTAAGAACAGACTGCAGAGGAGGAGTAGGCCATTCATTGAGCTA
GAGAAGACTAGCAGTTACATGTAGCTGTTGGTTTCAAGCAGAGGCCCAAAGGATTATCTG
CCGGTGGTCTTTGGCAGTTCTGAAACTTCAGCCGAGAATGGCCATTTCCTTTGGAAGAAA
CATCCCCCAGTTCTCCCTCCAGGTGGGAGAGTCTCAGGAATGATCCAAGTAATGGGTTCT
GACAAAGGTTGAGGGACAAAGATCGTTAAATGTGAGGCCATTGCCCAGTCATTTTCTTTC
TTCTGTCTTGTTCCTTTCATAAGTGAGTATTATGAGTTAATTTCATGTTTTAAGCTGCAG
TGAATGAATTTACGAAGAAGTTAAAAAAACAGAAAGAAAACCTTATGGATAGCATCGGAA
CATTGTCAGATACTGAAAACCTCGTGACTCACAGCAGAATAATGTCAGATCTAGAGCCAG
AAGGTGAGCTCCTCTGGTTAGAAGGTAGCCAACATATGTCTGAGCAAGCGCTGCCTCCTC
AAAGTATTGATGACCATAGTGATGTAGAATAAAGCCTTTAGGAGTAAAGCCTTTGGGATG
TTCGTTTGCACATGAGTCATAACTCAAAATGAGAAGAAACCACCACAAAGATTGATTAAT
AATTGAAACTTAGAAGAATGTACAAAATATGAATCAGGAACATTGGAAGTCATCCATTTC
TCCTCCAGTCCCTGGGAAGGGGCATCAAGCTTGGTAAAGTAAAGGGGCAGGGGAAAAAGA
AAACCCCGCAACAAAATGGATTGACACGTGGCTCTCACCTGACAAAGGTGAGGAGGGCGT
CGGCCTGGAGGGTGTTCTGTCCTGCCATTCACAGGGTCCCTGAGTGGGAACCAACCCGAC
GGCACCTAACAAGCTGCGAAACAAAATGATATATTCTGGTTAAAAATTTTGTCACAAGAT
CATTCGGTGACCAAGGATAGTTCAACTAACATGACTTCAATTACTCAAGCTAAAAAAATA
TGTTTCTAATTAAGTAATATAATGTCCAGAAGAATTTTAAGAGTAAAGGAAATAATCATA
TGTAGGTTAATTTGACAGAAAATCTAAAACACATATTTAAGCTCCTAGATTTGAATATTT
AAGAGAAAACCTCATCAACATGGAAGAAGAATTTATGGTGCCGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved