Echinops_telfairi Locus Mono:523:SNORA2
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:523:SNORA2
Echinops_telfairi
Mono:523:SNORA2
GeneScaffold_5866
SNORA2
1001..1136
1496
CTCCTCAGACTCATAGAGCCACATGAAATGATACAAAATGCGGGAAAATCACTGGCCAG
TGGGTGAAAAGTCTTATGGATCCAGTTGGCAGTGGATGCATCTCCAGGGGTCTTTCAGGT
CTCTGGCAGGTGTCTGAGTGGCTTGTTAACGGGAAAGGTGAAAGCACAGAAAGAGCGGGG
AGGTTCCCAGGACCCCTCCTTAGGAGGTGGTCACGCCCACAAGGAGGTACCATCAGGCTG
TGACCAGTTAGGCTAAACTCCACCCCTACTCTTCAAGGGGTCAAGTGGACTGGAAATTAT
GTAACCACCACAGTCCCTTTGCCTGATATGCTTTCTACCCTCCTTCCTTTAGATAGATTT
TAGTGCCCTGTGTCCCCAAAAGAGCCCTGGTTAAGTGTTGAGCTGTGACCCAGAATGGTT
GGCAGTTCAAACTTCCCAGCTGCTCCCCAGGAAAAGAGACCTGGTGACCCGCTCTAGAGG
GCAGGTCTATCCTGAGTCGGAATCCATTCGGTGACAAACCTAACCCTCTGCTCTGAGCAC
ACGACACCCCCTGAAAACCCGCTAGCATCACCTTCGTCACTCTCACTGTCCCCCGTGGTC
TCCCCTACCCACCTGTGAGGGCTTCTAGGTCAGGACCTCTGGGTTCCCCATGCCAAGCAA
ATGCCTGGCATGAGGTGGAAGCTTGGTGAATGTTGAATACACAGGTGAACAAATGTCCCT
TTCCCTCCACACCTGCTGACGAGGTAGTGGGAAGCTGAGCAAAGAGAATGGAGACCAATT
ATAAAGAGCTAAACACACACCCACATTTCCATTGATGGAAACACTTAGCCTCCCCCACCA
CACCCATGACTAGGCACAGTGTACTGACTGCACCCTGCTTGCATTCCTACAGCCCAAAGA
CTGAGACATGCCCCCCAAAGGGATAAAATGTAGTCCCAAGGGCATACTTGCAGTCCCCAA
TGGGCTGACTACTCAGCCACCCCAAGAAAAAGCAAACAGTCTTGGCCCTGAATCAAGGCT
AACAGTTTGATGGAGCTGTTGGCTTCAAGCAGGAGCCTAAAGAAATGTCTTCCTATGGTC
TGTTGGCCATTTCAGAACTTTGAAATGTAATGGTCAATTCATTAGAAAGAAACATCTGAA
AAAAAAGAAAAAGCAAACAATCACTATAGACAGAAAGAAACTCAAAAGCAAATTCACTGC
TGCCAAATCCATTTGGACACACTCTGCAGGTTGCTGAGGCTCATCTCCTGCAGCACAGTG
GGCGGGCTCCAACTCGAACCACCTCGACGTAAGGCCTCCCCACTCCTCCTCCTCGACTCC
GACTTCGCGCACACCTCTCTGGGGAGGCGCGGAGGGAGAAGATCCAATTACAGCTTTCTT
AACCTGCCATCCGGTGATGGGCTCACACTCCGCGCGAGCGGGATACGAAGGAAAACCCTG
GGTTTATGGTAAACGCCCACCCACCCCGGCCGGTGGAGAGTTGGTTATTGCTTTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved