Echinops_telfairi Locus Mono:73:SNORA71
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:73:SNORA71
Echinops_telfairi
Mono:73:SNORA71
scaffold_218421
SNORA71
1001..1136
2136
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAACCTTGACTGTTTGGGACACATGAGGAAGGCAGAGGTCTTAGAAGTGTGGATAAAG
TGAGCCTGGACCTTTGAAGTCTTCTGTAGACATAATTTGTTTCTCTCCCCTGTAAAGGGC
TCAGAATGCCCCACAGATGGAGCACTCAAGCCAGAGGCTCAGGCTGTGGCCGGGCCCTGT
TCTCATGGGACCACAGAGCACAGGAGCAGATGATTTAAGTCAGCAATCCCCAAGCCACAG
ACACCTGCCATTCCATACATATCCTGGGCTCATTTGACCTTTTAAAAATATAGATTCACT
TTTTAAGACTCACTCTAAGCAATCTCTATGAAATAGCAAGTTTTATATGTTGGTTGTATA
GTTTTCTTAACACTGTTTAAAATGTAAATGAAAAATGAACCTTTGGGAACCCCTTCAAAT
ATTTGCAAGTATCCCCAGCGGTATGCATGTCACATGCTGGGAAGCACTGGTTCAAACCCC
TCTTTGTTCTTCAGATGAAGGTATTAAGAGGTATGAAGGGGACCTGCATTCAAAAGTGGC
CTCGGACTGCCCGTGTCCTGGTCATCAACGATGCAGGGAGAGCGATTGCGGACAGCCGTT
TCCCGTGTTTGGAGGGTTCGGGGTACCTGTCTCTGCAAATGCTGGTGCTTTCACACAGTT
CTACTTCTCTCCTGCCAACACCTCCCGGCCCCAGGGCATCAGGGGCCACTGGGAACCGAG
AGGAATTCTGTGGTGACAGCGGAAGCCTTTCCAAGAGAGAAAGCTTCTTGGAGCACCGCT
CCCTGATCAGTGGATCTTGAAGCAGACTCCACGGAGACCAAAGCATGGACAACGGACGCT
CTCCGGGTTATTTGGAGTTGATCTCCGCCACTGGAACAAGCAAGCGTGGAGAGTGGGATT
GTTGCCACCGTGCAGCATCACAAGTCCCTTACCCGTCACCTCGGCCCAACATGGGACACC
TGTTCGCTCTGCAGGAGAGGGGCGAGAGGAAGGCCTGAGAGCCCAGAATTGGCACGTCTT
CAGTGGCCCTTTCAAAGCATGGCCACAGGCCCCTGGCCTGGGAAATGGAGGCTGGGGAGT
CCTGCCAGTGGCCAACCGTATCATCTCCCTACTTAGACCTGTATCACTTTTTTTGTTTGG
TATGTGATCAAATGTAAAATAAACGTTACCAGTTTCAAAAAAAAACTATATATATATTAA
AAAAAGAGGTATGAAGGGAGCCTGAATGTCATTCAGTGAGGGCACTAGCCCTGGAATAAA
CCATTTTAAATCCAGACTGTGGCCTAGGTCAGTGTACTTATATTTTTCAAGTTTCTGGTT
TTGCAACAATGGCATGAAGAAATTAGCACTGCTCTCTCCCCATCTTTCATTGGGAATGAA
TGGGAGTGCATGCAAAGCATTAACAAGCGCTATCATACAAGCTATCACCGCTTAGTCTGG
TCCCACTCTAGGGTCCTCTCTCTTGCCACTTGGCCAGCACATGGGCACCACAGGGAGTAG
ACCAAAGCCTCTGATGGACTAGCCAAATTCTCCTGGGGTTAAGCCTCCTACAGCCCCAAT
ATTGCTCTCTCTTCCCCACCCCCAGCCCCGGCCCCCATCACTCCTTCAAGGGGTAGGCTG
CTCACGGTGTCTGGGGCCACTAACACGTGAAAATTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved