Echinops_telfairi Locus Mono:543:SNORA42
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:543:SNORA42
Echinops_telfairi
Mono:543:SNORA42
GeneScaffold_2155
SNORA42
1001..1120
2120
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTCATCTTAAGGGGTGAAGAAATATTTTCTTTTTCATGCCCAAGAAAAG
AACTGTTACCACTTTCCTAGCTAATAGGAAGTGCATGACTTGGATAAGCATCTGTCTTCC
ACAGGAAATCAGCTCCTTGTGGGTAGTTTTCATAAATTTTCGTCTACACATTGCTCTTCC
CTCAAAGCTAAGCTTATCCTTTTAAAGTTCTTAAATAGTTACAAATCTGAATTTAGGTAG
GTAAGAACCTTTTTGCCTAAATTTGTAAAAACTGTAATGTTCATCTTAGCAAACAAATGC
ATCTTCTACTCTGATCATTCATTTTGCATTTCATATTGTGAGCAGTAAAAAACATGCTTT
TCTAAAGAGCAAGATCCAAGAAGAATGTATGAAAGGAATACTTTCTCCGAATCAAAAACC
CTAAAATATCAAACATGGAACTTCAGTTTTAGTCACTCACTTGGTCCTGTAGTTCATAAT
CAATTCTCAATCAGACCTAATCTAAATTTGATACTCCATCTCAGACTCTCAGAAAGCAGG
ATAAATGACAACCCTAATATGCAAGGGCTGATCTAATTCCATGAACTCCATGGGCTTTAA
TTGAAGTATGTACATTATGAATAATGCATAACTCCCAAAATGCATAGCTACTTTTGAGTA
AGTCAAAATGGAAAATCCAACTAAATCCCAGCGTGTCTTGAGGAAGAAAACAGATTCCTC
TATGAAGAAGCATCAGGAGGGTTTGTGTGTGTACCATGATTTATTTTATTTTAGCTTGAA
ATGAATATTTTCATATGGCTTACCTTTTTATTTAAAAAGATATCATAACATAATTGACCC
CTGGAAAAACAACTTCTCTAATAATTGAACTAAAACGTTTTGACCATCCTGGTCCAATAT
CAGCAAGTTTTAACACCCTAAATAGATTTTTGGCAGACAAATCATGAAGTTGTGCAATCC
CATGGGCCTCTAACAGTGTCCCATGCCAAAGCATACTGTAACCCCGAACCATTGCCTGGC
TTTACCCCTGGGCTTCAGGCACTGAAGCGGATTGCACAGTGAAAAAAAATAAAACAAAAC
ATTAAGTTAACTCAGCATATATTTTAGCTAACACTTATTAAATGTCCACCTTAATGTGTA
ATGCCCAAATAAAAGAAAAATAAGGCATATTTACTAAAAAGAAAAACAATTAAAATTATA
TATTGAAAACACCTAAAGAGTAATATAACTATATATAGGTACATATACATAGAAGTTAGC
ATACAGATATGTACCTATCTTATAGACATACACAAATATAAAATAGATATGAATAAATTT
TCCGTACATATGTGTGGATGCTATGCAAATTTAGAAAATCATGGATCATTCATTGTACAA
TTTGGTAGTCATCAGAGATAGCTTTTTAAAGGTGAAATAACATGAATGACAGTGAAGTGA
ATAGGCTATGCAAAGATAACACTGCTGTTAGGTGCCATCAAATCAGGTCTACGTGACAGT
GACCTTGTATACAATAGAATGAAATACACCCTTTCCTGTGCCATCCTCGCAATTATTGCT
ATGTGTGAGTCTTTGACTGCACAAAGGTACTAGAGAAGCCAAAATCATCATGTGAGAGCC
CGAATTACTGGAAATGTGTGATGTGCTAGGATTTGTTCTTAGCTACTCATGATAGAGTTT
TGAAAGAAGACAAAATGTATGCCTGACAGTGGGAGAGACCCAGGCAATAAGCAAGATCCA
AGAGTAAATAAATAACATATAATTAGTATTTTGTAAAAAATAAATTCCTTGCCTTCAGTG
TTAGACAAAGGAGATTTGATTTTGTAGGACATAAGAAACTAGTTCGAGAAAACCGTGAGA
GAAACAGTGCTTACTAGATACTCTGGGTGCGGTGTGCAGAGTGCGATGGACTCCACAGAA
CAGAGGTGAGGGAGAAGGGTTCTTGAAATCAGGGCAGTTGACACTGAGGCTGCCTCAGCT
TGAAGACAGTGTGAGTGTTGACAGTGGAAGGCATGCCACAGTTACTCCATGGGAGAACCT
GAGATTGACTGCTGGATATAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved