Echinops_telfairi Locus Mono:352:SNORD115
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:352:SNORD115
Echinops_telfairi
Mono:352:SNORD115
scaffold_306455
SNORD115
1001..1082
2082
GTTGACCCAAATATCAGCAGAGGCACCTAATTTTACGACAAAAACTGCATTAAAAATGT
GCTGAAAAACTCGGCTTATATACGAGTAGATATGGTTGATACCCAAAATGAGGCAGATAA
AGGCAGATATGGTTGATACCCAAAATGAGGCAGATAAAGGCATGAAGTGGCTGGCTCACA
AAATTTCATGGGTTGGGAAAAATGTTGACAGGATTATATGATTCAGGTATAGGTGTTCAC
AAAACTGCAGTTGTTAGGCTTAGAAGATTTTTGTTTTGTTCATCTATAGAATATAAGGTT
AAATTTGGCTGATGAATTTTCATTTGTACGTGTGTTAGTTGTAGCATGGAGGGTGCAAAT
ATGATTTCACTATTGAATTTGTTATGAGATGACGTATGGTTAAAAAGTTGTGTAATAGTG
TCAAGTTGATGAGGCGTGGTCTGTAGTAGTTTGAAACTTTTATGTCAACTAGACACTCAT
GGTTAGGGGTGGAATTAAACCTGTCAATCAAGTGGTAGCTTGATGATACCTCCTTAGGGG
TGTGGCTTTTTTTATAAGAGTGAGAGACTTTGAGAACTGCTGCCTTTCTTTGTCCCTCTA
CCTTCCTGCCAGCTGGACCTCTGCCTGCCTCCAGAGGGGGCCACCTGTGGACCACTCACC
CTGAGAGCTACCAGCACCTGCTATATTTCCATTGAATTTGAATCCACACAGCTCTGCACC
CATTGGTCTGTGATCTTCCTGCCTCCTGGTTTGGTTCACTTATCTGCATGACTGGCATGT
GGCTGCTTGAGTCTGAAGAGGGACTTATGTACTAGCATCGGATTTAGAGACTTCACTTGG
ACTGAGCTGGGATGCCTTCTTGATATATAAATACTTCTTGATATAAAGCTCTTTCTTATA
CATGGATGAATGTCCCTGGATTTCTTTCTCAAGAGAACCTGACCTAACACAGGCAGGAAA
GAAAGCAAAAACCAAAAAGGGTGCCAAAAAAGACTGAAAATTGTTCTTGAATGCAAAGTA
GATATAGCGAATAATAGAAATGATGAAGTAAAAACATTGAACAGAAGACAACCTAAGAAG
ACAAAAGGAAATATCATAAAGAAATATGTAACTACATGGATATCAAAGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAACCAGGGCTCCCA
AGTAAGATTTTCCTGAAGATAATTCAAAAGGAATTGCAGCAGTACATTAAATTCAAGGGA
GATTCAGAAGAGAACCTGTAACAAAGGATATTGTTGCTGAAATCAGGTGGATCTTGACTT
AAAGGAGCCAAACAAGCGTGGTTGGCCACCTACCAACCCACTGACCTAATCCACCAACCA
GTCAACCTTTATATAGGATACTAATTCTAAGATCAATTGTTAATAATGGTATATACGGAT
CTAGAAGCAAATCTATATAAAGAAGCATCAATAGAAAGACATAGGCTTGGATTCAGGATA
TCCCCACCGTATGGTCATGTGACCAATTCCTTCAACTCTGTATTTGCTCTTATGCTGATA
GCATGTTCTTTGAAGTTGATTACAGACTGGTAGGAGGAGAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved