Echinops_telfairi Locus Mono:131:SNORD111
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:131:SNORD111
Echinops_telfairi
Mono:131:SNORD111
scaffold_318077
SNORD111
1001..1091
2091
TTTGTGGTGGCTTGTTGATCTCTTTATTCTGAAGGTATCTTCCTTTTGGGAAGTAATTT
GAGATCTGTGAGGGTGATCTCTGAGGCTGTCCGAATAGCCCTTTCCTCAAAATCTTTATT
CCCAGGGCTTTGGTGTCGATTGACTTAATCTAAATGAGTTATTACATTGGTGTTTGCAAA
TCCAGTATTTTAGAGCTTTTATGGTGATATTACGGTAACTATATTTGACAAAAAAATGAG
TTACTACATTGGTGTTTGCAAATTAAGGGTTTTAGAGCTTTTATCATGATAGTAACGATA
TTTGAAAATTGGCTATAGTGACCTCATCAACCTTTAGCAGTTATCAGCACATTCCCAATG
TTGTTTTATCTCTGCTTCTCTAGTCTCCCCTCCTACTGATTATATATGGTCCACTTAATA
GTGAGTTACAGGCCTTGAGATTAAGGATTTTAAAATATATCTGATCTCATACATCTGTGG
TTTTCAACCTGTGCGTCACTACCCCTTTGGGGATCCAACGACCCTGTAGTAAAATGACAG
TTATGAAGTAGCAACCAAAATAGTTTTTTGTTTGGGGGGGTCACCACAACATGAGGAGCT
ATATTAAGGGTCGCGACATGAGGGAGGTTGAGAACCACTGCAGTACATGGTATCTGAGTG
AGATTCTGTGAGTCTTAGAAAACCTAAGGAGAAATTTGCCAAGTTAAGTGCGTCAAGGTG
TGGATAGACATTTGGTTTGGTTGACTAGATGTTTTATTGATCACCTACCTCTGCCAGACA
ATGAACTTGGTTTGGGGATACAAAGAAATTAAAGTTCAAGTTTCGCCCTCAAAGTGCTTA
TTTAGTGAGAGAAGTACAAAATGTTGAAATCTCTTTTCTTAAAAAGTTCAAAACCTTAGT
CAAGACCTTTTTGGGGATCCAGGAAGTTGATGAAGAATAGGAATGGACTGATGATGAATA
GTTATGGGGGAGTGTAGTGGTTGTATGTGAATGTTTATTCACCGCCTGAAATGATGATTC
TTCAAATTTCATGTCTCTTCTCTGATATGTTTCTCTGAAGATACATTTCGCCATACTGAT
CTGATCAGGCTATAGAGTGGAATTGTGGCCAGTGGGGGCACACAGGCTTCGCTACATCCT
TTGAGCAGAAAAGAATTTCTAACTACAGGCCTTAGAGATATCACGAGTTCAGTTCCAGAA
CACGCCAGTATAGCTAATATTGCAATAAATTGTGTCGCGTGCTATTTTGTTTGCTTGTTT
TCTAGTACATATAAAATGATGTTTAAACCATACTATTATACATTAAGTGTGCAGTGGCAT
TTTGGAAAAATTTTAAAATACTGTGAGAATTGCCAAAATAGGACACAAATATGAAGTGAG
TAGATACTGCTGGAAAAATGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTTTTTAGCCCAAACTGAGCAAGGGAGATATCTTCAAG
ATCACTTTGGAGACAGATGAAGATATGGTAAGCAAAGCATAGATAACTCAACCTTACTGC
CATCAAGTTGATTCTTACTCACAGCGATCCTATAAGGCAGAGTAGAAGTGCTCCTTAGAT
ATTCTGAGACTATAAATATTTAGGACTGCAAACAGCCTTATTCTTTTTTAAGTTTATATA
AACTTCCAAATATTTTAATACATATATTTACATAAATTTTTCTATGAATATATGCTGCTT
ACACCAATCAGCTCACATCTGTATGTTTCAGGTTTTCTGTGCCTCGCTTTGCAATCTTTT
TTAAAAAAAATCATTTTATTAGGGGCTCATACAACTCTTATCACAATCCATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved