Echinops_telfairi Locus Mono:345:SNORA18
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:345:SNORA18
Echinops_telfairi
Mono:345:SNORA18
scaffold_168540
SNORA18
1001..1123
2123
TTCCAGATTGAATACTTCAAGCCAGGGCCTGCACTTGCTGGCGTGGGATTTATGTAGAG
CACTTAACCTTAAGCCCAAATTATTCTGTATTGCTGGGAGAAATTTGATCGCAGTCTTCA
TTCATAGAATATTTGGAAACTAGCTCAGGAAAAGATTTGATTTCCAAATCAGCAAGACTT
TTCTAAGCATAAAAGCAAAGGGGGAAGGCATAAAGAAAATGATTGATAGCCCTGACTACA
TAGAAAAATATTTCAGAGGAGTATTTAATGATACAGGAAAGTGTTCGTGACATGGTGCTA
TATCAGGAAAACAACCCGAACATTAAAGTTTCACTTATGTAAAAATCTGTAAAAGAAATA
CAACTAAATACTAAAAGAAGTAAAGTATGGGTGCTATTATTTTTCTTTTCATTTCATTTC
CTTTAAAAAGATCAAAAATGGTTATTTTAAAAATAAATTTAAGCTAGTCAAAACTGAATG
TATTTCACTTTCATACTAAATTGTCAAACACAGGTAGTTTTAAAGGTGTTTTTGAGTAAG
TGGTTGAATTCTCCTTAACTAAATGCAGATATAAATAAGCCACGATTTATGAGAAGGTAA
TCTGGCTGGCAAATTGGAAATGGAATGGTTTGGAATGGAAAGTTCTTCTAGACTTTAAAA
AAGTAAAATTGGATCCTGTTACCGAAAGGCAGAGACAGAAAAAGAAAAACATCCCTGGTT
CCCCTGGTGAGCCTACTGTCTGCATGATGCAAAACCTCATTCCCAGCCCAGTCCCAGCCA
CACTAGACAAACTCCTCCATAAACTCCCACCTCTGCACGCCAATAGCAAAGGCCAATCTT
GGTACCAGAACCTAGATGTGATTCATTTTTACCATATTTATGACCCAAATACCGAAATAT
AGGAATAATCTTTCAGGGAAGGTGAATTATTTCTAGAAGGTATTGATAATGTCCTGGCAG
GATAAATAGCCATAGTTGGAGGCTCTAGTAAACTTAGTATAAAAGAGCGTTGCTTTGTCT
GTAGCCCCACATCGTTAGAAACGCCTCATAGAGTAACTCTGTGCTTTGCTTTACTCGCAG
AACTGCTATTGGTTGGATCTGTGAGAAAGAGCTACAAGACAAAGTTGTAGATAGTAGGAA
CAATCTAATAGGTACTTGGTTTTGATCACAGGTATTGGTGTAATCTGCACATTTCGTAGG
GACTGCAAGGGATTTCAACTCAATGTTCAGGAATCTGAAATGGAGAGGAAGGCAGGATGA
AGGAGCTCCAACGATGGCCCTAAAGGGAACAACAGAATTTTCAGGCATGACATGTTTGAT
AGTTGTCCATAACGGAGATTAAAGTGGTATAGCCAGAATTGACAGATCTGAGATTAATGC
CTACTGGACAGTATCTTGACAACGGTGGCTCCTTAAACAGGGCTATCTTGAAGATGAACT
TTTACAAGATTTAGAGGAACTAAATAGTAACTGATGGATGACAAAGACATGTAAAACTCC
TTAAATAAAATTTATTAACATTAAATAAAATTTATAAAATAGAAGCGTTTTCAATGTAAA
AAAAAAAAGGAGAGTTATCATAAACATTTGAAACATAATTGTAGAAGTCTTCCAACTGGG
TCAGCTTTCTAGGGTGGGGAAGCTCCCTCAGGATGCAAGAGCTTTTCAAGGAACACTCCT
TTGAAAAATCATCTCTTTCCGTCTCATATCTCTTCCTGCTATTAAAGATAGAAGTGCCCA
CCTTCTGCCATCAAGTCCATTGAAACTCATGGCAACTCGCAGAGTGCTCCTGAAAGGTTC
CCAACACTCCCTCTTGCTTACTGCAGACACGTCACCAGGAAAGACCAATCTCTATCAAAG
GACAGCACAGTTGGTAAAGCACAGGTCAGCACAAACCAGGAAACTCTGCCTGAGATGGGC
TGACACAGTAGTCACAGCAATGGATTCAGGTGTACTGGGAGACCATGAAGATGGAACAGA
ACAGGCAATATATGTTTATTTTATTAGTCATACAGACACCATGAGTTAGAGGCACTGGAT
GGCAGCTAACCACCACACGGTGATTTAAAACAATCGAGATATTGTTGAAGTATCTTTTAT
TTGGGGGAAAAATATCATCTAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved