Echinops_telfairi Locus Mono:65:SNORA30
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:65:SNORA30
Echinops_telfairi
Mono:65:SNORA30
scaffold_241889
SNORA30
1001..1129
2129
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAATGAACGATTAAAAAAAGAAAGAAGA
AAACAGAGAAATTCATGATTGGACCAACAAATGTACAAATGTGCTTGACACAATGAATGT
ATGTATGGATTGTGATAAGAGTTGTACGAGCCCCCAATAAATGATTTTAAAAATGCAGAG
GGAAAAAAATATATACACGTGTGTGTTAAAGACATATATAGTTATCTACACATAAAATGT
TGCTGAGGCTTCCTCTAATCCTGATGTCAAATTCATCTTCATATAATCTAGCTTCACCCA
TATTTGCTCAGCATACAGATTACATAAGTATGGTGAAAGGATACAATTCTGATACATACC
TTTCCTGATACTAAACAGTGTTGTATGCTCCTGTTCTATTGGAATGACCGCCTCTTAGCC
TATATGCAAGTTGCACATGTGCACAATTAAGTGTTGGGTAAAGCCCTGTTCACAATGCTA
TGAATATTTGTTATAATCCACATAGTTGAATGGCTTTTCATAGTCAATAAAACACATTAT
ATTTTCAGCCAAGATCCATGTGATATCAACAATATCTTTTGTTCGATATTTCTTCTGAAT
CTCTGGAATTTTCTTCTGGATCTACTGCTGTTAACATTGTTGAATTATATTCAGTTAAAC
TATTACTTCTGTATATTATTTGATAATTTCCACATTCTGTTGGACCACCTTTCTTTGGAA
TGCTCGCAAATATAGGTCTCTTTGAGTTGATTAATCAGGTATCTGTCTTCCAAATTTCTT
GACATAGACAGCTGAGTGCTTCCAGCATTTCATTTGCTTGTTGAAATATCTAAATTATTT
CATTAACTTCTGAAGCTTTGATTTTTGCCAACATCTTCAGCGTAACGGGCTTCTCCTCAA
TTCTTTATGGTATGCTACCCCTTGAAATAGTTGAACACTTTCAAGCACTTTTGCAGGTCC
TTCCCCAGGCTGTGGGACCAGGATTTGGTAGCTGGTGCTGAGGAAAAAACCTTTGGTTGC
ATCCTTGCCTGGGTCTGTGCCAGTGGCAGCTGTCAATCAATGGGGCGAAGAAAAAAAAAG
AAATAGTTGAACACTGATCCATTCTTTTCTTAACTTTTATGTATTTACTTAACTACTTAT
TCATTTATTCATTTTTAATTGGTTTAAAGTGTACACTTTGGTGGTGCTGTAAATTAGGAA
CTGAGCAGAGTTGGCTATTCCAATCCCCTAGTCACTCCCTAGGGAGAGAGATAGGTAATC
TTCTGTAAATGTTTACTCTCAGAAACCCTATATATAATTTCTATGACTTGGAATTAACTC
AATTGCAGTGAGTAAATACATCTTGGAACCTTGATGGTGCAGTGAGTTAAGCATTGATCT
GATAACAATCAGGCCAGAAATTTGAACACACCAGCCACTACAGGAAGAAAACGAGACCAT
ATGTTTCTATAAAGATTTACAACCTTGGAATCCCTGTAATACTGTGTTCTTCTCTGTACT
GTAGGGTCACTATCAGAATCAACTGAAGGCAGAGGATTTAATGTTTGGTATACAGTGAAC
CCTCGCCACTTCGCGCTTCGACTTCCGCGGCTTCACTCTATCGCTGTTTTTGCGTAACAG
CACCCACTGCCTACACCCGCTCCTTCAGAGGAAAAAGACGGCGACCCACCTGTAGAGTAC
ATCCCTTAAGTCATTTAATAGGCTATTGATTACAGTATTTGTAAGAACTATGTATAATAA
TACTGTATGTGAAATATGTAATACTGTAAACTAGATGCCATAAATAATAGAATAAATAAT
AAATGATAATTGTAACGTCCAAAATGTTTTACTATATTTTCCCTTTTTCGTTTAATAAAT
TGGGTAATACGAGTGTAATGGTGACTAAAGGGTGTTTTTTCATGTCCTCTATGCTCTAAC
TACAAAAATATTTTATTTACAAATGAGGAATCCTACTTCGCGGAATTTCATTTATCACGG
TAGGGTCTAGAACCGATTAACCGCAATAAACGAGGGTTCACTGTATACATCTTACCTTAT
CAGAATCTATTTCATTCTTACACTAGCATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved