Echinops_telfairi Locus Mono:576:SNORA21
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:576:SNORA21
Echinops_telfairi
Mono:576:SNORA21
GeneScaffold_427
SNORA21
1001..1137
2137
TCCACCCTCCCCGTATCGCCACTCTCACCATGGGTCTGGAAGGGATCATCTATACTGGA
TTCTCTGTGTTTCCAGTTCCTATCTGTACCAGTGTACATCCTCTGGTCTAGCCAGATTTT
TAAGGCAGAATTGGGATCATGATAGTGGGGGTGGGGGGGAGGAAGCATTTAGGAACTAGA
GGAAATTTGTTATGTTTCATCGTTGCTACACTGCACCCTGACTGGCTCGTCTCCTCCCTG
CGACCCTTCCATAGGGGGTGTCCAGTTGCCTACAGATGGGTTTTGGGTCCCCACTCCCCC
TCATTCACAATGATATGATTTTTTGTGTAGGACCACTTTTGTAGGATTTATGCTCTATAG
TTCTGAGCGGTCCACTGCTCAGTCCACAATACAGAGGAATAGCTTGCACGGGATCTACAG
TAATGCTGAAAATTAACAGCATGTGGCTAGCCATTCTTTGAGGTATTAAAAGATTAATAA
AGTAGATCCTGTCTTGATAAGCTTCCAGTATAATGAAAATATCTTTTAAAATTCTAAAAT
AAAGGAGGCAGTGGTAATACCACCTAAAAAATAGAAGAAAGAAAAAGAAGCAAGACTGGA
GAATTCAACACAGAATTCAAATGCAGAAAACCATTTCTAACTGAAGAATCACAAAAGCTT
CCATGGAGGAGGTAGCAATTGAGCTAAACTATGAAGGATTATAAAAATCCCAAACCATAA
CATTTCTAAAAACCAGAAGAGAGAAAATATATGAAACGGTGGATGAATTCTCAATTTGAA
AAAAAAAAATCAGGTAACATTAACCTTTCATAACCTGCTAGATCAAAATGTGTTACTGAA
TTTAAAAGTTTGATAGTCCCAGTGGTTTTTTCCCTTAATAAATGCTACGCTTAATTTTAA
GAATATATTTTACTGATATGTTTAATCGCAATCTCTGAAATGTAGACTTTCACAGCCAAT
AGCTGAGAATCATGGTCATAGCATTTCATACAAAGTGCCTCCCCCTTTTAAAAGCACTCA
TTGGGCCTTTTGCCAGTGACCCACTGAACCGTCAAAAGGGGCAGATTAAAAAAACACCAA
TTTTGGGTGAAGCGGCAAACATCTCATGTTGTTCAGCTTCAATCAAGATGTGACAAAAGG
AAAAAGAAAAAAGAAAAAAAAAAGTGCCATATAAATCGTGTATATCCTGAGTTTTTCAGC
ACATTTTTTAGGCAGTTTGGGGGTGAAATTAGGTGGCTCAGCTGATATTCGGGTCGGCTT
ATACTCGAGTATATACGGCACTTTTGAAGAAGTAGCAGGGAATCTGGGATAAGAAANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAGAAGGCACTGTGACC
AATGGCCGAGGCTCGAAACAGAGCCGAAGGCAGAGATTTCAGCAGCTAGACACACCCTCT
GCACAGGTCCAGCCGCCACCAGCCTGGTATCGGAACACCTACTCTACCAGGCAACTCTCC
AGCGCTCTACCAGTTCGGGAGACAGAACTAAGTGAGTGAACTAGACAAGGGCCCGCCGCC
TTTGAACTCACCCTTGAGGTGCAGAAGACAGAGAACAAGCTATAACAAGACAGGGTGGGC
TGTCAAGGTTCCACGGGAAGGATCCTAGCGACCTGGTCACACATGATCTCTGTAACTCGG
AAGGCAGTTTTTACTCACACCACACGTCGCTTAGCCCTCACTTACGGTTAGAGTAAAGTC
GTAGCAGTCGGGGAGCTCGTGCTGGCGCACTGTCTGCAGATTAATGGCCTTGAGATTAAA
TTGCAGCTCCACCTTGAGGAGTCTAGAAAACAGCGGGCGTTCAGCGCGGTGCAGAGGCCC
GCACGGCGAGCGGCACCCCGCCTGCTCCTCACCTGTGGAAGTCCAGCGTGAAGTTGAGCT
TATTGGGCTCCGGTGCTCCAGGGTGAAAGGGCTCATCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved