Echinops_telfairi Locus Mono:45:SNORA1
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:45:SNORA1
Echinops_telfairi
Mono:45:SNORA1
scaffold_324557
SNORA1
1001..1130
2130
CAGCATCCATAATTTTTAAACCTCTCCCCCTCACACCTCACTCCCCTGGTGATTCAAAT
AAGCAGCAGGCATTCAAAACGATTGGAACTCAAGACTTGCATGGTTCAGTGAAGAGGCAC
CATTCCTCTGAGAGGGGCGCATGAGCATCAGACTAAAGAGCAATTTCTTTTCTCTTATTA
AGTGATTTGGGTGGCAGGGGCGGAGGGCACAATAGGAGACAAAGTGGGGAGCAAGCACTG
TTGTGGCTCTAACAGTTGGCTCTGGGGGATTTTAACTGCGTTTGCTCATGGCCTTTCCTA
GGAAACCGTAGTGGTGCAGTGCTAAAGTGCTCAGCTGGTAGTTAGCACTCAGCACTGCTC
CATGGGAGAAAAGTCGTGGCAAACTACTCTCAGAAAGATTCGAGCCTGGCAACCCCCAGG
GGGCAGTTAGGCTCTGTCCTACAGGCTGTCAGGAGTTGGAATCGCCTCCCACGGAGAGAG
CATCCAGCTGGGATGCAGTTGCTGTGTAGCACAGAGACAGTACTGGGCAACCTTGACCAA
GAACACGGGTTTACTAGTTTCTGCTGGGCACCACGCAGTCTCACGTCGTAAAAGCTATTT
TCCCCTTCACGGGCTGTGGGCCTTTGGGAATGGGCTCTGCCCTGTAAGCCGGCTGCAGAG
ACGGTCCCACCATTTCAGTTCTGCAAACATTTGGCTCTTCTACTGAACGGAAGCCGTGTT
CACGGTACGTGGTCCTTCTTTTGCTATTCAAGAGAAGTGACCCTGGACTCCGTAATTAAA
CTTGGAGAAATGCACCCCACGTTTCCTCTGATTTTGATGGAATTATGATGCTTTTCATGC
TAATATAAATGTATTGGGGTTTCCCCGAAGAGACAAGAAACAAGCCACGGCCAGACATCT
GTGCCCCAATGTTCATCGTGACACAGTTCACAATTTTAAGGAGTTGGAAACAGCCCAAAT
TTCCATCAACAGATGAGTGGATTAAAAACGGTGTTACATGCAGCCTGAGTCTGTGAAAGT
GGGCACAGCTGATCACGGTGTCCAGACGGCAGTTGTGGCTGAAAGGATGACAGGTTTTGC
TTCCATCACTGTGGGTTGATTTCAGTGGTGACAATGAGACCTGTAACACTTTGCTCAAGC
AATACTAAAAGTTAACAATGTAGAAATATTTAGCACTAATACATAAATGTGCTTTCTACT
TCTAGGGCTCTAAAGGGAATAACAGAATTTTCAGACATGAGATGTTTGACGTCTGTCCAT
AATGGAGGTTAAAGTGGCGTACCCAGAAGAACTGACAGATCTGAGATTAATGCCTACTGG
GCAACGGTGGCCCTTAAAAAAGGCTATCTTGAAGATGAACTTTTACAAGATTTAGAGGAA
CTAAATCGCAACTGATGGATGACAAAGATACGTAAAACTCCTGAAGTAAAATTTATTAGC
ATTAAATAAAATCTGTAAAATAAAAATGTTTACAATGTAGAAAAAACTGTGGTACATACA
TACAATGCATACAATGGAGTATTACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved