Echinops_telfairi Locus Mono:289:SNORA27
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:289:SNORA27
Echinops_telfairi
Mono:289:SNORA27
scaffold_191411
SNORA27
1001..1129
1756
AGAGTTATGAATACTTCTTAGACATAACCAAACTCCTTTAGGGAATAAACTGCTGGGCC
TGGAGAATCAGGACCATCATCTCAGTGGAAAGTAAGGTCTATTGGTGCACCATAGATCAC
TAAGAAAATCTTCTACTTGCTCCTTCGGTGAGTAGTAACTGGGATCTTCAAAGCTCGTGA
GAAACCATCTAAAATGCAACCATTGCTCTTTCCTGGCCCAGAGGAGATATCAATGGTTGA
AAAAGAAGGCAATGGACACAATTAGCTCAGCCCTGAGACCAGAAGAACTAGATGGTACCC
AACTACAACCATCCACTGCACGGGAAAGGACCATATTAAAAGGCCCTGGATAGAATGGAA
GGATAATGTAGAGCACCATGCAAAAAGCATAGAAGAGACCAGGTTTACGGGTCAGAAAGA
GACTGTGACCCTTCTTCCCCCTGCAGGTGAAGAACTGAGCCCAACTCTGAGATGTTAATG
AGGGACAGAGCAAGCAGAACAGAGCATGGTATGTTGAATGGATTGTGATGGATGAGTGAA
ATCAAAGTATATCTGTGTTGCTTAATGTGAAACTGATGATTTGTCCTGTAAACCTTCACT
TGATTCACAATAAAAGGGTAAAAACACACACCCCCTTTTCACGTTGCTAATTGGACTTAT
GTCTTTATTGGTCATTCAAGAGGAGCAAAATAAATATCATGGGTGTTTGTCTTGGCAAAC
TGGGTGTTTGTCTTGGCTCCTGTCAGAAGAGACAACTTGAGCACATTGATTTCGGGGACA
GCTTCCTGAAGCACATGATGGAGAACGACCAGAAGAAGAAGGCCAAGGAGAAGGGCACTT
GGGCGAGGCTGAGGCGCCAGCCTGCCCACTCAAGAGGGGCCCACTCTGTGTGGACCAATG
GGAAGGGGCCAGAGGGCTCGAGCCCATTCCCTCGGGCCTACTCTGTGAAATAAAGCTGTC
ATGGACGGGGCAGGGGGAGACCATTAAAAAGTGTAAAACCAATGTGGTGATGATGAAATA
GAGTAAATAAGTGCTCAAACAAGTGAAGTAAAATAGTAACAATAGTCTAGGTGGTAAAAT
AGATGGTGTTCGCTATAAACCATTTCAGCTTTGCTGAATGTGGGACATTTCTCCTAAGAA
AATGGGAAAAATAACATCGAAGAGAATGGTAAAAAGAGGTGGCTCAGGGAAATTAGTTAC
GAGCACACTGAGGTGGCATGGTGAGATGAGATTTCTCATGCAGTCTCCTGCCCAGTAACT
AAGAACACAAAAAGTCTTTGCAGTTAAATACATACGTCCCAGACCTTCACCTAGTAGCTG
TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved