Echinops_telfairi Locus Mono:552:SNORA73
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:552:SNORA73
Echinops_telfairi
Mono:552:SNORA73
GeneScaffold_9034
SNORA73
1001..1200
2200
ACTCAAAATAAGAGCTTCATAGAACTTTGGACTTGTTAAGAATCTCAGTACCCCAATGC
TAGTTTTCTAGATAAAAAGCTTGGGCCTAAAGAAGCCTTTCCCAAGTTCTCTCAGAGCTC
TTGTTTCTTAACTTCTGGTTCAGGACAGATGGATAAGATAGCTGCCATCAAGTGAACTCT
TAACTCGTGGTGTCTCTATAAAACAACAGAAAGAAACACTGTTTGGTCCTACACCTTCCT
CATAATTACTGGAAGGTTTCAGGTCATCATTTCAGGTACGAAGCCAATCTTTACCTTCAA
GGGTCTTCTTATGGAGGATATACTCCATTCCACCACATATATTCTCCTCAAAGTGATCCC
TCCTGATGTGATCCATAGGTTGTCATAACATATTTTTCAGAAATAAATTGCCAGGCCTTT
CTTCTAAATCTTAGGTTGCTTGTCTGCTGAAACCACAGGTGACACTGCTGGGATTTGAAA
TACCAATGGCCTATACAGCTTCCAGCAAAACAATACACCAACTATCATAGTACAACAAAC
TTACAGGTGAGTGACTGCTTGTCGCGAATAGTAATGATTTTTCCTAATAGTCACAATACA
ATTTACATAGACAAAGGTTTTAATGCTGTTCTTGTTCTAACTCTGGTTAGACGTATGATC
TTTGAAGACATATTCTTGTCCGTCTATCTATAAATGGAAATAGAACCAAATATACCTACT
TCCTATATAATTTATAGTGAAGTTCTTAGAGGATGACAATGAGTGCATTATTGTTATTTT
TGAAGCTGAGGTATAGGGTGATAGAAAATATTATTCAGTAAGGTATATAAAGAAAAGCTC
CAGAGGGGCCAATTTGTAACAAGCTTTAATATAAAAAACCATGGTACATATCACTATTCT
GGGTTAATAAAGGGGTATATTTATTCAATAAAGGATGCCTGAGTAAGACATAAATTAGAT
TTAGATGACATTTTAAATAGAAAAATAAAACATACTACTCCCCAACATGGATACTCCCGG
GAGGTCACTCTCCCTGGGCTCTGTCCAGGTGGCATGGAGGACCACAGGGCTCAGCCCCAT
GATGTACAGTCCTTTTTCACGTCAGAGATCAAGCTGGGCCTTGAGTCTGCCTGCATATTC
CTACAGCTTCTCAGAGTCCCGTGGACAATGACTGAGGAGACAAACCACGTGGGAAACAGC
CCTCCACTACACCCCTCCTTTATTTAGGTTCTATTAAAGAAACACTTTTTAAAAAGGCAC
TACCCTCCTACTTTCTATATTAAAAAAATATGAAACTCAAATATTCTTAATTATATTGAT
TACAATTTGTGTGACCTTGAGGTAGTAGCTTAATCATTGTCTCAATTTCTTCATGTCCAA
AATGAGGCTAATAAGTACAGTACCTGGTTCATTCAAGTATTCAAGAAATGTCACCTATAT
TTATTATAGGGATCCTTAGTTCAGTGGGTTAAGCACGGGGTTGCTAACCACAAATTCAAT
GTTCAAACCCACCAGTCGCTCTAAGGGAGAAAGACGAGGTTGTCTTCTCCTATACAGATT
TGGTTTGGGAAACCCTAGGAAATGCTCTGCTGTCCACTAGGGTCGCTGCTTAGGAATCGA
CTTGATGGCAGTAGGCTTTATTTTTTTATATTAGAGTCCTTGGGTGGTGTAAACAGTTCA
TGTATTTGCCCCTCATCAAAAGACAAGAGATTCAAGAGTACTCACAGGAACCTCAGAAGA
AAGGCCTGGTGACCTAGTTTAAATAGTCATTAAAAACCTTATAGAACATAGTTCTGCCCT
GAAACATATGAGGTCATCTTGACGTAGTTGGCTGGCTGGCAATTATATCTTGGGTTTTGT
GTGTTTTGCTGTTGTTAATACATATTTGCTTCCCAATATGGCCAGTTAATATTTGACTAG
TTAATAATGTAATTGCACTGCATTTTCTCTTCTCACCCAGATCATGGCACTGGAACCACA
CAATAACCCTGTAAGGAAGAACAGCTATTGTTAGGTTTAGTTGAGTGTTCAAGGAAACGC
TCTGAAGTAACTAGAGGAAGATCACGCAGGGAAGCAACAGGAAAGAACAAAAACAGGAAT
GTTCCCTCTACCTCCATGCCTAATCCTGAGCTTCTAAAGGGCTACAGGGAAAGAGAACCA
ATGAGAGATTATTCAAAGGAAAGGGTAGATGTATNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved