Echinops_telfairi Locus Mono:250:SNORA40
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:250:SNORA40
Echinops_telfairi
Mono:250:SNORA40
scaffold_280391
SNORA40
1001..1127
2127
ACAAAACATTGTTCCATCCTGCAGCATCCTCACAACTGTCACTGTACTTGAGCCCATTG
TTGCAGCCACTGTGCCAATGCATCTTCTTGAGGGTCTTCCTCTCCTTTGCTGCCCCTCTA
CTGAACATGATGTCTTTCTCCTGGGACTGGTCTCCCCTGAGAATATGTCCAAGGTATATA
AGACAAAGTCTCACCGTCCTTGTCTCTACAGAGTACTCTGGCCTTATTTCTTCAAAGACA
CATCTGTTAGTCCTTTGAATAGTCTATAGCACTTTCAATATTCTTCTCCAGCACCATAAT
TCCACATCTAGTCTTCTTCCATCTTCCTTATTCAATGTCCAACTTTCCCATGCCTCTGAG
GCATTTAAAAATATCATAGATTTGGTCAGGCACACCTTAGTCCTCAAAGTAACACCCTGA
TTTTCAATACTATAAAGAGGTCTTGTGCAGCAGATTGATCTAATGCAACATGTCTTTTGA
TCTCTTGACTGCTGCGTCCATGAACATTGATTGGGAATCCAAGCAAGACAAAATCTTTAA
CAACTTCAACCTATTCTCCATTTATCATGATGTTGCCAATTAGTCCAGTTGTGAGGATTT
GGGTCTTCATTACATTGAGTCATAATCCACACTGAAGGATTGATCTTGCAACCCTTGATC
TTCAGCAAGGGGTTCAAGTCCTCATCACTTTCAGCAAGCAAGGTTGTGTCATCTGCATAT
TGCAGGTTGTTAATAAGGTCTCCTCCAATTTTTTTTTTCTCTCTTTTCTATTTTAAATTT
CCTTAAAAAAATAATTTTATTGGGGGCTCATACAACTTTTACCACAATCCATTCATTCAT
CTATTGTGTCAAGCACATTTGTACATTTGTTGCCATCATCATTTTCTAAACATTTTTTTT
CTACTTGAGCCCTTGGTATCAGCTCCTCATTTTTTCCCTCCCTTTCCCTCCCTCCCTCCC
TCATGAACCCTTGCTAATTTATAAATTATTATTATTTTTCCTGCCCTTGTGTTTGTGTTT
GTTTAATTAGTGGACAAACACTCAAAGACAGGTGCAAGAATAAATCCTCTTTTGCAACCC
AAAACTCATTGTGCAGCATGAGTTTTGATACAGATCAGAAGGGACACGTCATTAAACCAG
TCACGAGAGCACAGTGTCTGACAGTGTGGACACTTCCCAGGACTTGCTTTTGAGATGCTT
CAGATGAAACACAAACCAGGGCCCTCGAGGGAATAACAGACTTTTCAGACATGAAATGTT
TGACATTTGTCCATAATGGAGGTTAAAGTGGTGTAACCAGAAGAATTGACGGATCTGAGA
TTAATGCCTACTGGACAACAGTGGCCCCTTAAAAAGGGCTATCTTGAATATGAACTTTTA
CAAGATTTAGAGGAACTGCTGGATGACAAAGATATGTAAAACTCCTTAAGTAAAATTGAT
TAACATTAAATAAAATCTATAAAACAAACAAACAAAAAATTTTTTTTTCATGTCTTATAC
TGTCTGATGTCTCCCTTCATCCTCTTTTCTGTTGTCCGTCCCCCTGGGAGGGGGTTATAG
GTAGATCATCTCCTCCCATTTTGATGCCACATTCTTTCCATATAATCCAACTTCGCTGAT
GATTTGCTCAGCATACAGATTGAATACATAAATATGGTGAGAGACTATGACCCTGATGCA
CACCTTTCTTTATGTTAAACTATGCAGTATGTTCTTATTCCATTTGCACGACTGTGTCTT
GATCCGTGTACTAGTTCCACATGCGCATAAGGAAGTGTTCTAGAATTCCGATTCTTTTAA
AAGTTAATTGTAATTTGTAATGGTCCACACAGTCAAATGCTTTGGCATAGTCAATGAAAT
GCAAGTAAACATCTTTCGGTATCCTCTGCTTTTAGCCAAGATCCCTCTGACATCAGCAAT
GATATCCTTTGTTCCACACCCTCTTCTGAATCTGGCCTGAACCTCTATCAGTTCTCTATC
AGTGTACTTCTGCAACTGTTGGATTATCTTCAGCAAAGTGTTACTTGCATGTGGTATCAA
TGATGTTGTTCTGTAGTTTGAGCATTCTGTTGGGCCATCTTTCTTTGAAATGGATGCAAA
TATGGGTCTCTTCCAGTCAGTTGGCCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved