Echinops_telfairi Locus Mono:584:SNORA25
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:584:SNORA25
Echinops_telfairi
Mono:584:SNORA25
GeneScaffold_1562
SNORA25
1001..1128
2128
ACCCCCACCCCCACCCCGCCGAGACCAGCTAGAAAGGATCAAGAAGGAGAAATCTGGGC
GAAGGGACGCCTAGTGAAAGGGTGGGGGTATTTCAGCCTGAGGTGGTGAGGTGAGCCGTC
CAGTCGGTCAGAGACTGCATCGCAGAGCAAGGTGTCCAGACAAAACAAGCGCATGGACAC
TAAGCTTGGGTCTTCCGTGTGTCTAAAGTGGTGGCCCTGGGGAACATGTGGCCTGAAAAT
AGGTCTGGCTGGCCCTCAAATGCTAGACCTAAGCAGTTTTGGTTTTATTTTTAATTAAGT
GACTCCATTTTAAAAATCAGGAACTTCTACCACCACAACCCCCAAATCCTGATTGACAGC
TTCTTTTGAAAAATCTGATACTCTAGCAATGCCAAGGCTGCCCAGGGTCGAACCGTTTAG
ACAAGGGAATTGTTCTCCAATGCCCACAGGAAGCCTACTTCACCCCTTCATGTGGCTGGC
TGGACACGTTGAATACTTTTAAGTCCAAGTCAACCAATCCAGGGAATCTGCTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGCCGTGTGAGTACATGAGGTTGTTAGTATTATTCCTGTTGG
CACGCAGTCAGTGCTGACTTAGGACAAGGCCAGATTTTTCACAAAGTCCAGTTGCCCCAT
AGAGCTTGCCTGGCTGTGAGTTTTACAGAAGGAGATTCCCCGGGTCATTACAAAGAGGGC
TTGTGGGATGGAGACCAAGAGCTCCTAATGCTGTGACCAAGATTAAGATTCTCCACGGAA
TGCCCTAGTCACTCAATAGTGCTGTGTTTTCTCCTAAGGAGATAAAAGATTTTTTTTTTT
TTAAGATAGATTGCCAGGCAGTGCTTGCAGAAGTCTTTGAATGGAGTTGACCCACCCAAC
TCTAGGTTAATAGTTGTGTACAAACTATTTGTGTCACCACAAACCCACAGCCACTGAGCT
GATGCTGACGACAGTGACCCCTTAGGATAGTAGAACAGCCCCTGTGGGTTTCTGAAGCTG
TAAATCCTTAGGGGAGCAGAAAGCTCCATCTTTCTCCCAAGGAGGCACTGGTGGGTTCGA
ACTGCTGACCCTGTGGTTAACAGCCCAATGCATACCCCACTGTGCCACCAGGGACCCCTT
TGTGCTACCCTACTTGTTCCGTGTCTAATGAGCCACAAAACTCAGCGCCCGGGATTATAT
TGAAAAGTGTTGCTGAAAAGAGCTTATGGTTTCACCTTCTTGCATCTTCTAGCCCAGGGG
TTAGCAAACGTTTGAGATGGAAGAGCCAATCCTGTCTTGCACAATTTAAAAAGTATTCGA
GTCAAAAATATGTTTTTACAAGCAAATGAAACCGCCACTACCTGAATAATCATTTTATTT
TTATTTTCACTGATACTTCGGGGCCACATGTACGTACCGAGAGCTGCATATGGCTCTCAA
GCCGAGTTTGCCGAGCCTGCTCTAGCCCATTTGTTAATTTCCTCCGGAATGACTACATTC
TTGAAGTCGCCCACCCCCGCAACCTTCAGACGTTTCTCTTGGGTCTTGGCTCTTATTTCT
AGCACCCAGCAGATGAAGCACCCTACAGGAAGTGTATTATAAATGGTGGGAAAGATTTGA
ACAGATGGCTTTTAGACAACTAGAGATGACAAACCTAGTTTCTCCTGTACATGATAAGAT
GTTGGCCTTTTAAACTTCCATCTATGTAGCATGTATGTTGTAAGTGTGTGTATGCATATA
GTACACACCTACAGATGAGGAAGAGGTTCCTGGGTGGTACAAATGGTTTGTACTCAACTA
TTAGCCAAAAGGTTGGTGGTTCGAATCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved