Echinops_telfairi Locus Mono:157:SNORA30
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:157:SNORA30
Echinops_telfairi
Mono:157:SNORA30
scaffold_234935
SNORA30
1001..1134
2134
TATGGGAGTGTTTTAGTTTCTTCTTTAATCTGCTATTGGTAAAGTCCAGCCTTTAAGGT
AAAGTCTAGTTTGCTTAGTGGGAGTTTCCAGTTGGATCCTGCTGTGTGACTTATGAAGGA
AGTTTTGCACCTTGAAAGGACAGAGTCTGAAGTCCTGATGTCTATAGTATACAGCCTGGG
CCACCAAGGGCTGAATAAAAACTGGGTCATCAGTGGCCAGTTTGGGACATGATACTGAAC
TTAATCTCATTGGTGGTTTATATACTTAATTTTGAGTTTTACGCAGTGGCAGGCCCACTA
CGATTGTCCACAGACCAAAGAATAGTCCATCACCTTTTCTGAGACAGATATGCCCATCTA
CTCCACCACTTTCTGAATTGGGTTTCCAGTAAGGTTCACTAACCACTTTTGTCGAATGGT
CTGTTAATTTGGGGTGAACATGAAATAGTGTTATCTGGCAGGTGCTGGTTGGTCTTCTCC
CTCTCCTCACATCATGGGGAATTGACCCAAATGAGGTGAGGCCTACCTCTCTTCAAGGTA
GTTTTGACCTTACAGTTATCAGCCCAATGTGTGACTGCTCTGCCACCAAGGCTCCTATGA
TGTGCAAATAAGGGTCCTAGTAATGTTTTTTTCAGTTTAGTTAGTCCTTTGTAATTGTCC
TGCTCAATCATGGGTTAGCAGTTTTATAAACCCATCTACTTCTTTAGTTATGCAAAATCT
TGACTCAGGTTGCAAGAACATTTCAAAGTTATTTCAGTGATAATTAGAAGTCTGTGGCCA
GTGCCTGGCATAGTCCTTTTTCATGAGTCTATGAGGCAGTCCACATTTCTTGAAGTTGAT
GCACTTTGGCCTGAAGCTGAATTGCAAGCTCTTTTAGTGAATTGTTAGATTAATGCAAAC
TATCTGTAAATGAGAAGGTTAAAATGGAGGTGATTAATTTATTACAGATAACTTTGAAAG
TGAAACATCTGCTCTGAGTTTGTTATAAAAGAATGCAATTGCCAGGACTTTTCACAGGTC
CTTCCCCTGGCTGTGGCATCAGGACTTGGTAGCTGGTGCTGAGAGAAAACTCCTGGGTTG
CATCTTTGCCCTGGGGCTGTGCCACTTGTAGCTGTCTGAATGTATGGAGAGAGCGAAAAC
AATAATACAATTGACAATGAAATTTAGTTGTTTTTGTTGTATGCAAAAAATCTATTAAAA
TGTTTTAGTCAAAATATTGCTATTAAAGCATAGTAATTAACTTTATTTTTAAAGCTGTGT
GCATAATAACATCTAACTTATGAAACCTTTGCAGAGAAAAAATGTCAGATATAATGTAAT
GGTCCTGAGACACAATATAATATGCTATGAATATATCAAGTATATAAAAACTGCATAGTA
AAGGCTCCATAGAATTTTTAATAGCTGATTAATATATATATATGAATTATCCAGACCTAT
CTCCTAAGGCCCCTCTGACTGGACTGGAACATCAACCTTTTGGTTAGCAGTTGAGTGTGT
TGACCACTTGTATTTTCTAGCGATTCTAACAAGCCTGTAGTTAGCATTAAGATACGAGGG
AGTGACACAGGGAATCCAGGATAGATAAATCCCTCAGGAACAGTAATGGGAATAGTGATA
CCATGAGGTAGGGGAAAGATGGGGTGGGGAGAAAGGGGGAACTGATCACAATGATCAACA
TAACGTGGGTGAAGGGAGACAGCGGATGGTATAAGATATGAAAATAACAATTTATAATTT
ATCAAGGGTTCATGAGGGTGGGAAGGTGGGGTAGGGAGGGAAAAAAGAGGAACTGATACT
AAGGGCTCAAGTAGAAAAAAAATGCTTGGAAAATGGTGATGGCAACAAAGGTGCTCGACA
TGGATATATGCATGGATTGTGATAAGAGCTATATGAACCCCCAATAAAATGATTAAAAAA
ATTTTTTAATTGTCTGAAGTCATCCACCAATGACAAAGACTTGTTTAAACATGTTTTATT
GGGAATAAACACATGATTTATGAATTGTGAAAAAATGATGGTGGCAACATATGCACAAAT
GTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved