Echinops_telfairi Locus Mono:162:SNORA71
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:162:SNORA71
Echinops_telfairi
Mono:162:SNORA71
scaffold_188410
SNORA71
1001..1128
2128
CTTGGCCTCTCAGCCATGTGTCCTCTTGACCTCTGTCCTACTTGGGCAAGGGTCACAAA
GCTCCTTTAGCTCTTATAATAAGTACCCAAAGGGCATCTGTCCAGGAGCCTCCTGCCCCA
CGGCACGCAGCTTTCTCCCTCTGTGGACTGGGAAGCCGGATGAGCCCTGCTCATGGTCTT
GACTCTTCTGCCGCCGTCATCATGGCCACCACTTTTCTGTCGCATCTCTGATGGTACGAC
CCAGCTGTGTCTCCTGGATTGAAGCGGTTCCACAAAGGGCTCTCTGGGTTCAATGGGCAC
CTTCTACCCATCGTTCTTGACGGTCGTCAGTTCCTCCTACTTCTGAGATGGCTCATTTCA
TACCCAGCTGGATGGCAAAACTCATCGTTGCCCATGTGAGAGTTTCACACACTCTATGTG
CATGGTCCCACCCAGTCATCTGGCGGGAGGTCGAAGGACTTTGGCCAGAAGAGCCATAAC
TCACTGGACCCGAGGGTGACTTCCCACAAAAACTCCCTGCTCTCAAGTCAACCCCAGTTC
ACAGTGACCCCAGAGGATGGAGCGGAGCATCTCCGGAGTTTCTAAGGCTGTAACTCTTGC
TCTTCTGGAGGGGTTGTTGGGGGTCAAGCTGTGGGCCTTTTGGGTAGCAGCCCAAGGCTT
AACCCACTGCCCCTCCGCATTCCTTGTGGTGGAACTACTCATGTTATTTATGACTGTTGG
ATTGGCCCCTGGCTCTGGGCAACCCCATGCGCAGTGTCTCCAACATACTGCCTGCTCCTG
ACCCTCCCCACGAATGGGTGTGAATCCAGCAATTATGATCCATCTGGAACAGCGGTTCTC
AACCTGTGGGTCGCGACCCCTTTAGGGTTTTAACGACCCTTTCACAGGGGTCGCCCGATT
CATCACAGTAGCAAAATGACAGTGATGAAGTAGCAACGAACATAATGTTATGGTTGGGGG
GTCACCACAGCATGAGGAAGTGTATGAAAGAATCTCGGCTAACCTGCATTCAAAAGGGAC
CTCGGACTGCCCGTGTCCTGGTCATCACCGATGCAGGGAGAGCGAGTGTGGAAAGCCGTT
TCCCGTGTTTGGAGGCTTATTTGGAGTTGATCTCGGGCACTGGAACAAGCAAGCATGGAG
AGTGGGATTGTTGCCACCGTGCGGCATCGCAAGACCCTTACCCCGTCACCTCAGCCCAAC
ATGGAACACCTGTTCACTCTGCAGGAGAAGGGCAGAGAGGAAGGCCTGGGAGCCCCGAAT
TGGTGCTTCTTCAGCGGCCCTTTCAAAGCAGTACCACAGGCCCCTGCCCTGGGAAGTGCA
GGCCGGGGAGTCCTTCCGGTGGCCAACCTTATCATCCCCCTACTTGGACCTACATCACTT
TTTTTGTTTGGTTTGTGATAAAATGCAATATAAACATTACCAGTTTCAAAAAGAAAAAAG
AAAGGGAGTCTGGATCCATCCATTTGAGTCTGGAAGCTCCGCTGAAACCTGATTAGCTTC
ATAGCAACACACGAGGGGGCTTCAAAGAGTTCATGGGAGAATTCCATGCTCTTTTCATTT
CATTTCTCCCACGAGCTCTCTGAAGCCTCACCGGACACAGGCCTCCACGGACAGAGAGGT
GGGGAGATGCCTCGGCCAGAATCAAGCCTGGGTCTCCCACCAGGAAGGCGAGACTGACCG
CTGAGCCGCCACAAAATAATCCAAGGGTTGGGGCCCAGTGACCATAGCTTGTGCAGAGAG
CCCCACCTGCTCCAAGCCCTGACCAGCCCTTTGGGCCCCGGCGCTTATGTCTGAATAGAC
TGTTCAAAATCAGTGGACGTTTGCAGGGACTTCTCACCGGGGAGGCAGACGCCCAAACAA
ACAGAAAAAGAATTGCGAGGTAATGCAGAGAGACAGAGACAGACAGACAGACAGACAGAC
AGACAGACAGAGAGACCCAGACATAAAACAAACCCCAAAGCCTACAATGAATCTCTTCCG
AGAGTTCAGCGAATCTACTAGGCCCACGTTCTTTCCAAGAAGGCGGTTTCGGAAGTTTAA
TGGAACTCCAACTTGCAAGGGAACACTTGGAAACCCAATTAGGGACAAAGTAGGGACGTT
AACTTGCTCTATAAACTTTCACCCGAACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved