Echinops_telfairi Locus Mono:612:SNORA51
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:612:SNORA51
Echinops_telfairi
Mono:612:SNORA51
GeneScaffold_4090
SNORA51
1001..1125
2125
CAGGGGCCACCAGGGGCCACCAGGGTCGCTTAATTGTATAGCGGGATGTGGACATTTCC
ATTGCAGCCAGACCTGAAAGAAGGGGTGGGGAGGAGAAGGATGATTACCAGACAGGAATA
AAGAATTATTGGTCCTCAGACTAGTTCTTTATAGAGTATTGGGACTGTTTCTAAGCCTCC
CGACTAGACGCTTGTCACCTTCCAATAACATTTTGGACATCTGCCAGACAAGAACTCCGC
CTTACTTGCTACCTTCTCTTCCCCTTCTCTGCTCTGTTTGAATCTTGGCTATCCCAGGAA
CACCATTACCGATGCATTAGCTCCTGACTGTGCCAACGGTAACGAACACGCAGGCTTTAA
ACGTAGGATGTGTAATCCCAAGCAGTTCAAGGAAATCTGCTCTGAGATCCCATTGCCTCT
GTGTGTGGCCGTAGGTGTGGTTGGTATATATCTGTCCACCTTGGGTGAGATCAAACCCGA
GGACATCTGTGTTTTCCATCCAATACTTGGATCCCCTCTGGGTCATTTCAGATGAGAGAT
CTTGCGGCCTTTGCTTCCACACCTACTGCAGTTGAGAGGTCCTGGAAGCCCAATTGCCTT
CAGACGGCGATGACTGCCAGGAAAGTTCTAGTACCCCTGCCTCTTTCAACCAAGTAACTT
GGAACTTACCTGGCAGTCCTTGCACACACCACATGTTGAGAAGTGTTAGGGGATTTCAAT
CAGTTTTTATGATAATTGTTGTTGTCGCAACATGTTTTCGTTTATTTATTAGGTGTTTAA
AAGTTGGCTTAACCACTCCCCTCTCTCTCTTAATGATGAGTCATGAACATTGGTGTTCCA
GATACCAGCAAAGAAAAACAGTTTATTTTGGCATTCTCTCTTGGATTTCCTCACGATTCC
AAATGCACGAATACAGGTCAACTGATGTTTTTAACTTCAGTGTGCAGATTTATCTTCATA
AAACAACTTTTTGAACACACACACCAAAAGCCCTCAACCAGAGCCTCCTTGAGCTTACCA
CAGCTGTGCTTTTGCACTTACTATGCAGAAGCAGGAGGCAAAGTGCCCTGTGTACACCGC
AACCCAAGCCCTGTGCCGGGTTTGTATTGTGAATGGGGCAACATGGCACTGGAAAGAAGA
AGAAGGAAAAATCCCTAAACCAAACTTACTGCCATTGAGTCAATGCTGACNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved