Echinops_telfairi Locus Mono:446:SNORD66
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:446:SNORD66
Echinops_telfairi
Mono:446:SNORD66
scaffold_266045
SNORD66
1001..1066
2066
GAAACATCTCATCCCATGAATGGACCTGGAGAACATTATACTGAGTGAAATTAGCCAAA
AACAAAACTACAGATATTACATGAGACCATTGTGATAAGGAAAAACAAAACAAGTTAAAG
ACTTTTGTACCAAGGGAACAGACTTTGGAGATTTCTGAGTAGGGAAGAGGAAGGAAAGGG
AAGGAAGGTAATGGAACACAAAGGGCTAGATTGTGTGTGTGTGGGGTGTTTGTGTGAAAT
TAAAGATCGCAGTCCACAAGAGGGAGAAGAAAAATAAAGGAGCCAGTGAAAGAGAAACTA
CTGGGGGGTGGGGGGATGGTGTTAATTAGTATTTTAAACTGTGGGATACAAATTGATGAT
CAGGAATGTAAATTCCCACCTAGTTTACAATAAAAAAATTATTATTAAAAAAAGAAGAAG
AGTCATCCACCATGAGTAAGAACAGGCTTGATAGGAACTAACAACAATCATGTGTTACAG
GGTTTCTCGAGACAAAGAAATGACCTTGTTCAGCTTTGTATTTCTGTTGCCTAGAAAAGG
TGATGACTTACAGTAGATATCAGATAAATATTGAGTGACTGAATTGAAGGATAAAGAATG
AAGGGAAAACAATTCAGTTGGCCAATACGACCTTGTCATCTTGGGGTATTGTCACAATTT
TAAAGAAAGTCCATGTCAGGCTATGGTTTCCTTTTCACCCACTCCCAGCCCATAGTACAG
TCATAATGGTATCTTGCCAACTGCTTTCCTCCAGTTGCTGAAGGTGCAGATGTCCAGTAC
GTAATCACATCCTGTTAGTCCCCAGAAGTTGGGAAATAAAACCATATAGAACCTATTTTT
CATCCTGACTCGTGTGTCGGAATTCTGCAAATTTTCTTCTGGTGAGAACACTGGGCTCTT
TAACACATTGAAAGCAGGTGCTGAGTTGTTGTTCGTCCAGGTCATGCAAGACAGAGATTC
TATAAATTCAGAAGTTGTGAGCTGGGGGTACGGCTGGCGGGTTCCTGTGATGACTTCATG
TTCAAGTATAAAGAGGAAACCGAGTTCTCAATGAAGGGGCCGAGGATGAAATAATTATCT
TGGCTGGATTTGGGACTGAATCTTTCCAAGTATAGGATGGGACATTCAATATACTGAACG
TGATAGGGGATGGAACTGATTCACCAGATGGTGAGGAAGAAATCTAGCTCTTCACATTTT
GGGAGATAACATTTCTCCTACTGCCTGCTGCTTGACATCTTGTATTTCTAGATTTTTCTG
TTAGAGGAAGAGAGTGGATTGGGGACATATAATCCTTATTGGAACATCACATAGTGTCGG
TCCATTCTAGCTCTGCTACGTACTTGCCATGAGGCCTTGGCCAACTTACATAATTGCTCT
GTGCCTATATTCCCATTTGTAAAATAGGGATAATGATAGTATCTATTCCATAATTATTAA
GGTTAAGTGTACAGATACATATAAATCACTTCAAATTTTATCTGGTACTAAGGGAATGGC
ATGGGGACTGGGTCTGATCTCCAGCTGCACAAGAGAGAAGGTGGATCCAACCCCACATCA
GCGCAGGATGATTCCTGGGAGGCTGCGGGCAGATACACTGCCACCCTCCAACTTCCTTTA
CCCCTTTTTGACACTAACCATCCCTCTCACGACACCCTGCTTCTATGCTGGGTCAACAAT
CATCTCAATAATTCCAGCTATCAGGTACAAAATGTCAAGGAAATGATTCTTTGGTCTGCA
GTACGTTTCTCGGTCATTTCTCAGCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCGGTCAATTCTTCAGGTCCGACTTCACAGGCTATTGCAGTTCGTCACAGTCG
CTTGACATATGCCTTCCACGCGCCTCGAAAGTCCCCGGCAATATGCATCAATATGTCAAT
GTGGATCCTCTGCTCTGCCTCACAGTTCTGACACTGCGCCTCTGCTCGCGTCTCATGAGT
CTCCGTCGCTTCGTCTCAGTGCTTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved