Echinops_telfairi Locus Mono:108:SNORA36
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:108:SNORA36
Echinops_telfairi
Mono:108:SNORA36
scaffold_300419
SNORA36
1001..1122
2122
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTCCAACCGTGTGAGGCCTGTCCCCGCAGCGGCA
GAGAACCGATGAGCGTGACTCTCCAGACGGATGTCGCAGGCTGCTCCAGCGGCATTCGCC
TCGTGCTCTGAGAAGCGCAAACCCACGGTTGGTTGTGATGGACGTTGTGATTGCCCAGAC
TTGAAAGTGTTCCTTAGAGTGACGAAAATAGCCTGACTTTGTCATGAAAGTTTCGTGACG
CACGTGTTAACTTTCTATCATTGATAGACAATTTACCTCATAAGGGAAAGGCACCAGGAT
GACTTTGTCACTTTATATTCCTTGTCAGTAGAGAAATGTGATTTTTGGCACCTCAAATTA
GACCATCATTCAAGCAACTCAAAGTAATTTTTGAGGCTTGATTGGCGTGTGGGAAAGTGA
TGTATCTCTTTCATTAAAAGATGCATATGATGAGAAAGGAAGCCCGATGTGCTCCAGTAA
AACAAAGCCCCCAAATCTTGACATGGATAACACGGAGGAAGAAAGCCAATCAAAAGTATG
CTCTCATCATGCCAGGAGCATCAGTCTAAGCTTTTAGAATAGTGAGGTCTTTGTTGTTGT
TGTTGTTAAGTACCTGAGATAAAGAGAGCATTGAATTGCTTTTTAAAAATAACATTTACA
GCTTCCCTGTTCTGTTAATTAAACTTTGGGACATTAAAACAGGCTTGGGAAAATGACTGG
GTAGAAAATATTATTCTATTCACTTTGTTCCCAGCCTACATTTAAAAAAAAACAAAAACA
CACACATTTATTTGAGAAATTAAGATGCTATTTTTTAAAAAAAATGACGGACTAAAAATA
TTCCATCCCATGGAAGATATCCAGTCCCTTTTATCTTGTTTTATATTAAGTGGTATTTTG
AAGAAATATTCAAAATCTCCTAAGAGAGGATTCCATCATAGGGTAGAATATTAAATAGTG
AATTGCTATGCTTTTGTACTTATGAGCCCTTTTTACATCAAGCAATTTTTAAAAGGGTGA
ATCTCTTTATCCCATACAGCTGCCACATGCATTAGATAGGGGTATAAAGAAATGCCAACC
TGTGGGGTGAGAGGACTAGAGCCCATGCGTGCCGGATAGTGCCGATTCTAGCAGAGACTT
AGCATTGTTTTCTTTTTTCTCTGTGATGCTGGCTTCCCAACTCAGCTTACAAATGGAAAA
ATATGAGCCTTTTAAGAGAGGCCTGGAAAGAGATGATTCTCTATGCTATCAAGTACCTTT
CTTTTGAGGGCCTTCAAATGCTAAATAAGACTATGGGTAAATGGGTGCAGCACTCACAGC
TCCCTCAAGAGAGAAGTACATCCCATGAATGTTTAATCTCATATTTAATAGAATGAAAAA
GGAAGCCTCTTACTCATGTGCAGAAAAAGGGCAAGTCCAAATACAGACACACTCACAATA
CATGTACCTGTGTGGCTAAGTACATGTGAGTATCGAAAAGGAAAAATAAAGATACCACTT
GCAATGCATACAGGCTTAGAGACTTCTATGTATTCCCGTGCCCTCACTTTCCCGCATAGA
TAATGTTGATAGTGCCCATGACAATTACACCAAGAACCAAGAGGTTTTTCCTAAATTGGG
GACCCAGCTGATTTCTCCTTTGCTGATTTCATACTATTAATCACTCGTACCATCCTTCGA
TTCAACTTTAAAATAGACATCTTTTATTAATACATACCCTTGTTTAACAGTTGTTGTTTA
TCTTCCAAGGGAGGGCACGTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved