Echinops_telfairi Locus Mono:611:SNORA38
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:611:SNORA38
Echinops_telfairi
Mono:611:SNORA38
GeneScaffold_7797
SNORA38
1001..1128
2128
ATGAGATGTAAGAACATAAAATGAATATGAATAAAAACAGAAGCCCGCAACTTGACACA
AATACTCACTTTGTGATATAGCCTTGTCCATACAGACTGAACCGAAACATATGTACACTA
TGACTTAACAGTTACACTGCCAGGCCTGTCAAAATGCAGGCTTTCACCAAAAGACAACAG
AGGTTTGTGGAAACCCTTATTTGTAGAGCAAAATGTGAAATTAACCAAAATAATAATAAA
TAATGGAAATAAACAGTAGAATATTCACAAATGTATTGCCTTACAGCAATGAGAATGAAC
CATCCCCAAGTGCGCATAAATATATGGGTGACGATCAGAAACGCAATGTTGAGCTGAGGA
GTTCAAACATGTAAATGCAGGTGCCATGGTCCCATTTGTGTGAAGTACAGAGCAAGAAAA
ATGGATCTGTGCAATTATTAGTGAGGATAATGGTTTCCTGAGCAACAGTGACTAGAAGAG
ACACCAGAGGGTTTGTGGGAGTTCTCTTTGTATCTACTTGCTATTGGTGCTGGTTACAGA
GTTTCTGTTTGTGCAAATTTTTCACGGAGGGTGAGTGACATTGCATGTCTCTTTTATTTT
AGTGCAAACACTTGAAGCAATACTGTACCTTGAATACGTTAGAAGGATTGCTTACGGGGG
AGGGCATGACAGTGGAAGACGAAAGAGACTGGATGAGTTTGTTAGTTCTAGGATGAACTT
TAGAATGTCAAGATGGTTCACCTTTTGCTTTAAGAATTTTTAGAAAAATTGTAGAAAATG
CAATCAAGCAAGCAATTGTTGATGCATTGTTACTACAAACTTGAGTACTTAATTTTTTTT
TCCACTGTGCAACCCGCTTCAGTGCCTGACACCCACGGGACAAAGCCAGGTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATTGTTTGTCCTCCTACAAAAGGCGTG
TCTGTAGTTCCCTGTCCTGACATGTAAGAATGGAGGCCAAAGAAATGTGATTAGGAGCAT
TTGGGGCCAGCTTGCTCCTCGCAGTCTCCAGCACCCCCATCCCACACTAAAACTAAAACT
AATAATAATATTGTTGTGCTTGGGTGCGGCCAAGTCAGTTCCAACTCACAGCAACTCGGT
GTAACAGAATGAACCTCTGCCCTGTCCTGTACCGTCCTCATCATTCTTAGGTTTGAGCCC
ATCGATGAGCCACTGTGCCAATCCATCTTGTCAGCGGTCTTCCTTGTTCTCTCTGCTCCT
TAACTTTACCAAGCAGGATGTCCTTTTCCAGGGACTTGGCTCTCCTGATGGCACATCCAA
AGGACTTGCATTCTGGCTGTACTTCTTCCAAGACAGATTTGTTTGTTTGTCTTTGGCAGT
CTATGGTCTTTTTATATTCTTCACCAGCACCATAATTCAGATGTATCAATTCTTCTTTGG
TTTTCCTTATGAAATGTTCAATTTCTACGTGCATATGAGATCATTGAAAATATGACAGAT
AGGTCAGGCCCACATTAGTCCACCAAGTAACATCCTTGCTTTTCAACACTTTAAAGAGGT
CTTGGGCAGCAGATTGACCCAATGCAATGCATCTTTTGCTGTCTGGATGGCTGCATCCAT
CCATCATGTTACTGACTAGCCCCATGGTGAATATTTTGGGTTTCTTACTTTGAGTTGCAA
CAGATACTGAAGGCTGCAATCCTTGATCTCCAACAGCAAGTGCTTCAAGTCCTCCTCACT
TTCAGCAAGCAAAGGCACGTGATCTGCATATCGCAGGCTGTTAATGAGCCTTCCACCAAT
CCTAATATCACACTCTTGTTCATATGGTCCAGCTTTTCTGATGGTTTGCTCAGCATACAA
ATTGAATAGTTATGGTGAGAGGCTGCAACCCTGACTCAGACTTTTGATTTTAAACCACGT
TGTATTCCTTTGTTCTGTTCACACAACTGACTCTTGATCCATGTACAAGTTCCACATGAG
CACCATATAGTGTTCCAGGATTCCTATTTTTCTCAAAGCTATCCATAGTTTGTTATGGTC
CACAGAGGAGAATGTGTTTGCGTAGTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved