Echinops_telfairi Locus Mono:33:SNORA36
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:33:SNORA36
Echinops_telfairi
Mono:33:SNORA36
scaffold_215579
SNORA36
1001..1132
1406
GCTACTAAAAAGAAAGATTAAATAGGAGACAATTTCATAATAAAACCCCCCAAATACCT
ATCATACAATGATAAATTACTTGTGACACAAGAAACAGAATAAAACACAACTTGTATGAA
AAAAGATAATCAATTGATGACAGCTGAACCGACTCAGGATTATCAGGAAAGTATTTTAAA
GCAGTCATCAGAAAATGTTGCTTCAAACAGCAATGAGGAATTCTATTGAAAGAAAAAAAA
TCCTAGAAAGGAAAAGAAGCAAAATATTTTAAAATTTCCAAGGGCTTCCCAAGTGTTGAG
GGCAGCTTCCCTGTTCTATTAATTAAACTTTGGGACATTAAAACAGGCTCGGAAAAATGC
CTGGGTAGAAAATATTATTCTATTCCCTTTGTTCCCAGCCTACATTAAAAAAATTCCAAG
GGTAAAAGAGAATTAGTAAACATAATAAACAAAATAAAACCCTTCACTATTTTAAAATTT
ACTGGCATGTAATTTGCGTATAATACAATGTAACAATTTATTCATATTAGGGAGATTTTT
GCAATCACCACAATCAATTTTAGACTTTTTTTTCTCATCTCCTTGCTGTGAGGCCCCCAT
TTCCAGCCAGCTTCCCCTGCCATGTCCCTCTCACTCCAAGGGAGTCCATTTTGACTCATA
ATGACCCGACTGGACAGTTGAACTGGCCCTGTGGGTTTGGGGGGCTGTACCTGTTCAGAC
CACCATTTGTCTGCTAGTTTGTCTAATGTGGTGGCTTGTGTGTTGCTGTGATGCTGGAAG
CTATGCTACTGTATTTCAAATGCCACCAGGCTTATCCAAAGTGAACAAGTTTCAAAGGAG
TTTCCAGACTAAAAACAGACTACAAAGAAGGAATTGGCTGTCTGCTTCAGAGAAAGTGGC
CACTATAAATGTTATGCATATAATTAAAACATGGTTAGATACTGAAAGCCTAATGAATGT
AAGCAGAACACGGTCAGAATTAGTGCAAGTGGATGGGTCTCTTAGCTTGGAAGGCACTTG
AGATGTTACTTAGGAGAGCGAGATTCCCAAAGTAGAGTTGACCAGGGTGACATGAGTGGA
GTAAAGCCTGTCAGAGTAAAGCCTTTAGGATCTTCATTTGTTGATGGGAAACAATCAGAA
ATTAGAAGAAACAATAGCAAAAATCTATTAATAGCCAGAATTGGAGTGTACCAAGAATGA
ATCTAGGAAAAATGGAAATTATCAAAAAATGAAATGAAACACAAAGCTCAATATCATAGA
CTTCACTGAGCTGAAATTGATTTGAATCAGAGAACTGTGTGTTTCCCGATGGCAGGAATG
AAATAATCAAGAATATGGCTTTGCATTAATTGCCAAAAAGGACGTTTCTTTTTTTATAAA
TCATTTTATTGGGGGCTTTTACAGCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved