Echinops_telfairi Locus Mono:217:SNORD88
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:217:SNORD88
Echinops_telfairi
Mono:217:SNORD88
scaffold_281079
SNORD88
1001..1092
2092
AGGCAAGATAAGTGTCAGGCACATTTGAGAGTGTCAAACGGAAGTTCAGGGGCGTCAGA
ACCTTGCACAGGTCATCCTTCTCCTAATTGGCTAATGCTCACATACTTGATATCCTCTCC
ACAACGGTGTCCTTGAAATAATGTGGCATCTCTCTCTCTGGCTTATTGAATGTATCTGCT
TTTGTCTTCCTTTTAAGCTTCTAGTTTATATTAAGTATTAAAAATATGCAGAAAGTTGGA
GCTTAAATGGCAACTATGAGTAATTTGATAGTAATCAGGAAAGATGACCAAGAAAAATGA
ATTTTGTATCAAATTGGAAATTAAAAATAATCACAGGTAAATCATAAGCTAAGGATCATA
TTAGTCTTAAACCTTTAAATTTCCAAAAAGTATATTTTATACTACTTTCTCCCAAGAGTG
CATTGTGGCAAATATTAATAGTCCCCCAATATCCATTTTTCCATCTTCCTTATAGTAATG
GAAGTGCTAACAACGCACTGGGTGTCCTTTACGTGTCCGGTCATATGGTCACCAGCTAGG
GACTGTATTCCCAAACATTCCTTATCAATGCTGTAATCAGATAAGTTGTTTCAAAGCAAT
GTGAGAATAAGTAAAGAGCTTAGTTCTAGGATCAATTCCTTAAAATAAAACATTTTGTTC
TTTATTTATCGTTTGCTCTTTTCTGTGTGTCATAGGGGCAAATTTATTCTAGAAAGCATC
TCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCCTCC
CAACTACATAAAAGTAGTTGAAGGGAGACAGTGGTTGGTATAAGACAAAAAAAAATTATA
AATGATCAAGGATTCATGAGGGAGAGAGGGTGAGGTGGAGCGGTGGGAAAGGAGCTGATA
CCAAGGTCTCAAGTAGAAAGAAATTGTTTTGAAAATGATGATGGCCCCCCATGATGTCTA
GCACTGGGCTCCGACTGCCCCTGCGGACACTGTGCCCCCCAGGACCTTTGACACCTGGGG
GTCTGAGGGGCCATGGGGAAAAAAAAGAAAACGATGATGGCAACATATGTACAAATACGC
TTGACACAATGGATGGATGGATGGATTGTGATGAGAGCTGTAAGAGTCCCCCAATAAAAT
GATGAAAACAAAACAAAACAAAAAACCTCTACAGTGACTTGTAGGTTAACAAAAAGGAAA
GAACCTGGGAAATCTGACTGAGAACTCTCTATTGGTAGGGGCTTGTCCTCCACTAAGAGC
AGGGTAGCACTCCCTGTGCCAACAAAGCTCCTCTTGGTACTTGAACCCAAACTCCCTGCT
GTGGAGTCATTGCTGACTCCTGGGGACACCACAGGACAGGGAAACACTGCCCCTGTGGGT
TTCTAAAAACAGTAAATCTTTACCTGGGCAGAAATCCTCACATTTCTCCTTCAGAGGGCT
GGTGATGGTTTCAAGCTGCTGGCCTTTTGATTAGAGGACCAGTACCTCACCCAAGACACC
CCCAAGGCTTACCCTTTAATCTGACACTTCCCACTTCCCCTGCCACCCCCTCCATCCCCC
TAAAAGAACCACTGATCCAGTTGCTGCCTCTCCATATCTCTGGTGAAAACTTGTGCAGGG
GGTTTCCAAAAATTCATAGATAAATACATTTAAGATAGTGAAATTTTTACACAAACTTTT
TATAGCCTCTTTGCACATCCTTGTAACCTCTGTGTATTGTAGACTTTAGCATCTACTTGG
TGCTCAGCAAATGTTGTTTAAATGAATATATGCAAGAATGACTTGTGTTTATTCTAAAAT
GAATATAAAGGGTTTTAAAAATTCATGGAAAAGTAGAATGAAAAGATGGAATTCCCCCAT
AAGCTTGTGAAGCCCCTTCATATTTGCAATTAGAGTTTTGACACGGTGATAGTAGGAGAG
AGTAGACCCAAATTTAAACATATGAGTAAAAATGTCCTGGCAAATGTTCTGATGATAAAT
AGAAAACTAAAAGAGGTGTTGTGTCTCTCCAATTGTCTTCTGCAAAGGGAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved