Echinops_telfairi Locus Mono:464:SNORA44
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:464:SNORA44
Echinops_telfairi
Mono:464:SNORA44
scaffold_213334
SNORA44
1001..1129
1929
TAATTGTGGAAAGAGGTGAACCCCCTTTTTTTTTAATCTTCCTTCTTTTCTGGTGGGTC
CTTTATTTTTAATGTGGTCCGAGAAGGTTCTGGATAGAACTTCTTGGTTTGGTTGAATCT
CGTAATCCCTGCCCAATATCATGCCAATAATCCTTCTTTAGCTTTCCCAGTCCTCCCCCT
AGGGAGCTTTTGAGATTTCCCAATATATAAAAATCCATACCCATCTAGCAAATACAAATG
ATTTCAACTTCTTCATTCCCCCAGGGGAATATCTTTGGTGTCTTTTTCTGTGCCTTATGC
TGTTAGCTAAGACCTCTAGTACGATGTTAAATAAAGAGTGAATACAAGGGGCATCTTTGT
CTGGTCCCCTTTTTCAGTGAGATTGCTTTTGTCTCTTATCAAATTGACTACCATGTTGGC
TGTTGATTTTTCATATATAGCTTGTACTACATTGAGGAATTTTCCATTGCTATCTTCTTG
AGTGTCCTAAACAGGAATTGGTGTTGGATGTTGTCAAATTTTTCCATCTATCGATGTTAT
CATGTGGTTCTTATAGTTTTTCATGTCACTGTGGCAAATTATACTAATGGTCTTTCGTTT
GCTAAACCATCCGTGGTATGAATCCCACTTGGTCATGGTGTATTATTTGTTTTATATATT
TTTGTATTCTCTTGGCCAGTATTTTGTTAAAGATTTTTGCCTCAATGTTCATTGGGGATA
TTGTTCTGTAGTTCTGGATTATTGTGGGATCCTTGTCCGGTTTTGGTATCAGTTAAATTA
GCTTCATAGAAGGAGTTCAAAGAGCATGTTCCCAAGGACTGTGGCTAGTGTAACCATCTG
ATCTCCAACTGCATCAAATAGAAACTTGTAGAGACTTTGAAAGCTCTGTCAGCAAAGTAT
CTGCAGCTGCCACTCACCTTTCCTGTAAAATTCTCCAGGATCTGGACAAGGAACCCTCCT
ACATTAGCCCAGTTTTCCATCAGCTTCCATGTAGATCTGTGGCTAGTAAACCAGCCTTAA
AATGTGGTGACGCCAAAAAGATCTAGAGTTTTGAGCATTGAAGCAGTATGAGAAGAAAGA
ACTTCAAGCAGGCTGTTTTGTATGCAGTTGAAAATTTTTTTTAATGTACCTGGATTAATA
AATAAATAAACTTGTGGGAGTGGAGGGGCAAAAAAAGGAATTCGAGAGTTTGCCTTCTTT
TTCTTTTTTTAGAAAGGCAGACTGCCACATGCAGCACCTCATTTGGATGTGTCTGGAGTC
TTGGAAGCTTGACTACCCTACGTTCTCCTACAAATGGACCTTGAGACTTGTTTGGAGGTT
CTAGCAGGGGAGCACAGCTACTCGTATACCCTTGACTGAAGGACGGTCTTCCTTCTATTG
GGGAAGGTCGTCCTCTTCAACCGAGCGCGCAGCTTCGGGAGGGACACACATGGAGCAGTG
AGGGAGGAAGGGGACACCTGCCTAGCCAGCCAGATCAGCCGAATCAACCCTGGTGATCAA
TGGGGTGACAGATGTCGCAGCCAGATCGCCCTCACATCCGCCTTCTTTTTCTATGCTCTG
GAATAGTTTGTTAGGGTTGCTGTCAGTTCTTCCCTGGATGCTCGGTAGAATTTTCCTGTG
AAGCCCTCTGCTCCAGGAGATTTTTTTTTGTTGGTTATCCCTCAATAAACTTGTCTATTT
ATTCTATTGCTATGGGTCTGTTGATATTCTTGACTTCCGTTGGGCATAGTCTACTGAGGG
ATTGTTTTTCTAAGAATTTGTCCATGTCTTCCAAGTTGCTGAATTCATTGGAGTACAGTC
CTTTGTAGTACTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved