Echinops_telfairi Locus Mono:423:SNORA73
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:423:SNORA73
Echinops_telfairi
Mono:423:SNORA73
scaffold_77437
SNORA73
1001..1174
2174
ACAACTTTCCTCTAGTTCCTAAATGCTTCCTCCTCCCACTCCCCACTATCATGATCCCA
ATCTACCTTACAAATCTGGCTAGACCATAGGATGTACACTGGTACAGATAGGAACTGGGA
ACACAGGGAATCCAGGGCGGATGATCCCTTCAGGACGTGTGGTGAGAGTGGCAATACCGG
GAGGGTAGAGGGAGGGTGGGGTGGAAAGGGGGAACCGATTACAAGGATCTACATATAACC
TCCTCCCTGGGGGACGGACAACAGAAAAGTGGGTGAAGGGAGACGTTGGATAGGGCAGGA
TATGACAAAATAAAAATTTATAAATTATCAAGGGCTCATGAGGGAGGGGGAGCACGGAGG
GAGTGGGAAAAATGAGGAGCTGATGCCAGGGTCCTACGTAGAAAGCAAATGTTATGAGAA
TGATGAAGGCAATGAATGTACAAATGTGCTTTACACAATTGATGTATGTATGGATTGTGA
TAAGAGTTGTATGAGCCCTAATAAAATGATTTTTAAAAAGAATTGTATATATATATATAT
ATATATATACATGTACACACATGTATATGGCAACAACAAAAATATACCTACATCATTAAA
ATGTCAATTAAGGAACAGGGCCTGCATCTCCCCAGGTTGCTCCGACATGCTAGCCTTCCC
GCTCCAAGCCTGATTCACAGGTTTGTGGCTGAGAGAAGAAGTGGCATTTGGAGACAATTC
TTTTCATTACTTCATCTTTTCAAAAAGTCCATGAAAAGGGCCTGCAGGAGTGTCTTTGTA
CTGCTCTTGCAGCATTTCTGCAGCACAGATTATTTCAAAATGAAAAGGTTAAAAATGTAT
ATGCTGCAAAATACATTTTTTGAAAGACATTTTGAGACATTCAAAACAGTCTGAAAATCA
AAACCCAACAATCAAAAAGTCTAAAAGTGTACTCTTCCCACACCTGTCCCCAATGACTCA
GTTCTCCTGCTCAGAGCCAATGTCAGTTTTCTATGTCTCTTGCATGTGCGTGTGTGCGTG
TCCAGGTGGCATGGAGGAGCACAGGGCTTTGCCTGTGACATACAGTCCTGTCCCACAGCG
TCAAGCCGGGCCTTGAGTCTGCGCCTGCGTATTCCTACAGCTTCTCAGCGTCCTGTGAAC
AGTGACTGAGGAGACAAACCACACAGGAAACAAACAGCCTTCTACTGCACCCCACCTGAA
CCGAGGCGCCGTTCGATGATGAGTTAGATTGCTTTCCACTTTTGGGTGTTTTGCAGGAAA
ATAATCAGTAGAAGAGCTTGGTGTTGAAGACGGCGCTAAGGAAGATGGACTGACTCTGAG
CGTCTGCTGGCGAGGGCGTGCTGGGGCGGCTCTGGCCCGGGCTGGCCTTTCCTGATGAGT
GGAGGGATGTGTGTGCGTGCACGCATGGGCTATTCTTCTCAACAACAACAAAAGGGCCAC
TTTTATGTTCTGTTTTTCACCTCCCGAAGTTAAACTTTTATTTTTAACTGTGTCTAGTAA
AGAGCTGGTTAACAAATTATGGTACATCCGACACTGAATTACTATGCAATGGGACGAAAG
AATGAGGAAACTTGTCATGGCCTATAATAAGTTACCTTTTTCCTTTTTTAAGCAAAAAGA
CATATATGCACACGCACACGCTCACGTTGGGAAAAACTGACCATTTTAAAGTGAGTAATG
CAGGGAGACTTTGGACAGTCACAATGTGGTGCAACCGCCAACTCCAAACTAGTTCTAAAA
CATTTCCACCACTCCAAAATAAAACTCCACACCCCTTACACAAGGAGCCCTAGTGGCTCC
GGGTTTAGGCACTTGACTGCTAACCAAACCAAAACATCAGCGTTTCTGAGCCAACCAGGT
GCTCGATGGCAAAGAGCCCACGAGTCACTCCGTGGGGGAAAAGAGGTGGCAGTCCGATTC
TGAAAGACTGACAGCCTGGAAAACTATGGGGCGGCCCCACCTGTGCTATAGGGTTGGAAT
CAACTCCCGGGTCCACAGGCCCACCCACAGAGCAGTTTCTCCCCATTCCTCGGTGCTCCG
AGCACAGCAGCCAACAAGCTGCTTTCTGACTGTGAAGTTGCCTCCTGTAGACAGTTCAGG
TTCATGACACCTTACTATTGGTAGCCTGTTGGGCTGTCTTCTTTCACTTGGCATTCAAAC
TCTTGGGCCTACCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved