Echinops_telfairi Locus Mono:114:SNORA70
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:114:SNORA70
Echinops_telfairi
Mono:114:SNORA70
scaffold_215190
SNORA70
1001..1133
2133
GAAATTCTTATTTCATACTAAGTCTAAAACGAGTTATTAGTATGTTCTCCATATTGTAA
AATGTCTTCAAATTGGCCCCTGACTCATGGCAGCCCCATGCACAATGAAATGGAACACTA
CCCTGTCCTTCATAAACTCCAAGGTCAGTGATGAAACAGACTCTTTTAATCCATAGAAAT
AGATCACCATGCCTTTGTTCCTAGTTCATCTTAGCCTGCAAGCTACACTAAAACCTGTTC
TTCATCATAGCCACATGGTGGACAGCTGCTGACTGCACTTGAGGTAATGGGCTGGGAAAC
AAACCCAACTCTACCACATGTAAGACAAGAATTCTAGCACAGAACCACCATGACTCACTG
CTCCAGTTGTGACTCATAGCAACCCTATGTCCAACAATATGAGACATTTCTAAGTCCTGC
ACCATCCTCACAACTGTTATGTTTGAGTCCATTGTTGCAGCTACTGTATTCGTCAAGTGT
CTTCCTCTTTTCCACTGACCTTGTACTTTACCAATCACGATATTCTTTTCCAGGAACTAG
TGTATGCTAACACATCCAAAGTATGCAAGACAAAAGTCTTGCCATCTTTGCTTTCTTGTT
GTTAATAATGTTCATTTGAATGAGTAGAAAAATACCTTATCATATACAAATATATACCTT
TTACTGAAGCCTTAATTGCAAGTCCTGGTATTAAAGTGGAGCCCTGATTTAATAGTGGAT
CCATGTTTGGCTAAGATCTTCCAGGTCAGAAGTTCAAAACCACAGCAGCTCAGTAAGAGA
AACACCAGGCTTTCTACTCCTGGAAACAGTTACAGTCTTGGAAACTCACAGGAGCAGTTC
CACCGCTGTCTTACAAGTGTCACTATGAGTCAGCATTGACTTGATGGCAGTGGGTTTGGT
TTGAGGATTGTTGTGTGGTTTGTTTGTTGCATTAAAGTAGATATTTAGTGTAGTAAAAAG
GGAAATCATTCTTATCTGAAAGAAAATTAGTTTTAGTTTATCTACAGCCAATTAAGTGGG
CCACCCTCCATCTCACTGGGGCCGGTGTTCAATGGCCTCGAACACCAGCCTCTTTGGTAA
TACATGCAACCTGTTAGCATGTATAGGCTACTCTAAGGGACCTTGGAGATGGCCTTTGGC
TGCTTTTTGAAGACTCTGGTCAGGCTAATTTCTACTGTTCCTAACCTAAGATCTAAACTG
GGATATAAGGTGCTTTGGGGAAACCCCAAGTCACAGTCCCTGGGGACCAATTAGCTAGGT
CTTTCTTCATGTCCATCGCACCAAGCTTCAAAACAAGGAGCATGTGAATGAGGCTTTACA
AGGGCCAAGTTCAAGTTCCCTGGTCACCAGAAAATCCACATCTCCAAGTTTCATGTTAAT
GAATTTGAGGACATGGCTCCTGAGAAATGTCCCATCCCAGAATGGTTTTAGAGTCAAATA
CAAAGGGGTACCAAAAAAAAAAAGGATTTTTTTTCCAAAGTTATGAATTTAAATGTTTTT
ATGTAACAGCCTTATCAGCTTCAAAGTACTCTCCATTACACTTAATACATTTGTAAAATT
TGCGATTCCATTCTTGGAAGCATTTTTCAAATTTATTGGATTGGATGGCTGACAGCACCT
CCATTCTTTTTTGCTTCGCCTCCTCTATGTCGTCGAATCACTGTCCTTTTATGTCCCTCT
TCATGAAAACAAAAAGAAATGGCAGGGAATGAGGTCAGATGAGTAAGGTGTGTGAGGCAA
AAGATGCATGCTGTTTTATGCCAAAAACTGGCTCACTGAGATGGCTGCATGAGAAGGTTA
ATTGTACTGGTAGCAAAACCAGTCCCCCATCTGCCATAAATCAGGCCTTTTTTTGTCACA
CACTGTTACACAATCTGTGCAGAACCTCTAAATAGAAAGCTCTATTAACTGTCTGACCTG
GTGGAATGAAATCCAAATGCACTACGAGTGGACACTTTTGTCTGTTTGGGAAGTTGATGG
ATGTCCAGAATGAGGTTTGTCATCAACTGACATTTCACCTTTTTTGAAACTAGAGGACAA
CTCATAACGAGTTTTTTCCATAGCACAATCCTTGTAAACTGTGTTCAACATCATAACAGT
TTTGTGGCATTTTTCCAGAGCAGGAAACAAAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved