Echinops_telfairi Locus Mono:41:SNORD116
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:41:SNORD116
Echinops_telfairi
Mono:41:SNORD116
scaffold_187603
SNORD116
1001..1085
2085
AGAAGTTTTTAAAAAAAGGAAAAAAATATACATAATTCCAGGTTTGTTTGCTGACCTTC
ATGACTATCTCCCCACTAGTTATGGGGACTCTCCCCCTCCCAGCCTGAAGCCCATTTCAG
GGGCTCCGCAGGGGCTTCATAGCTTTGCTTTGCTTCAGTGGTTGATCAGTTATGTTCCTT
TCTTGGTTTGCCCCACTGTGGGGGGTTCAGACAGCACTGCCTCCCTGCTGTGTGGCCCCA
TGTTTGTCCTCTGTCAACCTCTGCTCCAGTAAGGGGATAACATGGCATGAGGTGTTGTTG
GCCCCACAGTCCCCTCTGTGTCCCAGCCGCTCCCCACAGGGACGTCATCCTCTGGGCCTG
TTGTGCAGCATGGGGTCCAAGACCAGCTCTCCCTTTCTCTTCTTCCTTCCTGGTCTGCTT
CTGTGTGGGCGTGGCATGTTGGCCCCTATCCCAAACTTTTAGGTTTAGTGATTGAATTAG
ATCTTTAAAGTCATTCTGAGGACTAAGGTGTACCTGCCCCAAACCATGATATTTTCAATT
GCCTCATATGAATACGAAAACTAGACAATGAATAAGGAAACTGGGGAAGAATGAGTGATT
TGAATTCCAGTGCTAGCAAAGAATATTGAAATTACCACAGTCTACCAAAAGAACAAAATG
TCTGTACTGGAGGAAGGATAGACAGAATGCTCCTTAGAAGCAAGGATGGTAACGCTTTGC
CTCATGTAGTTTGGACATGCTCTCAGGAGGGAACTGTCCCTGGAAAAGCACATTCTGATT
GGGAAACTAGAGGGTCAGCGAAAAAGAGGAAGGTTCTCAATGAGTTGGATGGGCACAATG
GCGGAAACAGTGGGGTCAAACAGAACTGTGGCGAGGCTAGCACACATGTTTCCTTCTGGT
GCATGTAGGATTTCTGTAAATTCTATTGCTCTTGACCGAACCAGGGCACCCAGAAGGTGT
TTGAAAATATCTGAAAGATCTGATCTGTAAGAATAAATTGGAGATTGATCATTATTTCTA
CATAGACATTCCTTGGAAATCTGAACAAAATGAGTGAAAAATCGCTAGCATTTTGCTTAG
AACTTTGTAACATAAATGGAGCAGGGCAGAGGTCCAGGGGCCATGTGGTTGGGAAACCAA
GGACCAGCGGTTGGCCTGCTTGATTATAACGAGGCTGTTCTGATGGAAGGTTCGTGTTAT
CCTTAATTATAACATGTTAACTGCCCTAATAAACTCCATAATTTGGGGGCGCCGTGGGAG
AGGGGATTCAATGGAATATTGTCTGCATTGTAAAGAGGTACAGTCTCAGAAACTCAGAGG
ATCAGGTCTACCCTGTCCTATAGGGTGGCTATGAATCGGCATAGATTTGATGGCAGCCAC
TATTTGACTGAAAAAGCTTTAGACACGATTGTCCACCAAGTTAAATAGAAATACAGAGCT
TGAACCATAGGTGATCTTACACAATGAAACAAAAGCATTATCCAGCTACTCAGTGGTGCT
GGGGAATGACTCATTCTTCAAAGTCAGGTTATTTGTACTCTGTTTCCCTTTGCCTTCTGT
GGGTGTCATTGTGAACTCAGAGACCTACGTTACCCCTGCCAGGCTCCGCCAGGCTAACAA
CTCATGCACGTTCTGGCCAGCTGAGGCCCTGGGCTAAAACATGTGCAGTGAAGGGGTTCT
CCTGGGGATTGCATATTATGACAAGAGAGTCACAATGACATTTTTAATTTGATGAGGGGA
TAAACTAAGTGTGGTCTACACTTTCAAATAACCTGATATTGGCAACATTTCCTCCCCAGA
ATGGTAGAAACTAGGAATCTACCTCAAGCAAAATGAAGCATTTCAGGATAGGTCTTGCGG
TTTCTTATTTATCACAATTTTATGCAACCAGTTTTCAAGGATAAATTTGTGGGAAAGATC
AAAATCAAGTACTAGGAGAAATCTTTCCTATGGTAATTTGGCCATGTTATCTAATTGCCA
AATATTGAATATAAATGCAGAAATGGGAATATTCTAGGGATTCAAGGCTCTGGCAAGCTG
CTGGAATTTCTGCTGACCAAGAATCCCTGGTTTCAGGGTGGGTCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved