Echinops_telfairi Locus Mono:520:SNORA61
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:520:SNORA61
Echinops_telfairi
Mono:520:SNORA61
GeneScaffold_1121
SNORA61
1001..1119
2119
TCAAAATAATCCTAGTAAAATGGGTAATGTTACCATCACCGTTTTATGGTAAAGGAAAT
TGAGATACAGCAAGGTTAAACAATGTGCCCAAAGTCACAAAGACATAAAGCAATGGAGCC
AGCATTTCAAGTAGGGCAGTATGGTCTTAACTATTTTCCATGAGATTTGTGTTTAGGAGG
CCAAAAAACCTATGATAAAAACAATGACCATACCATGAAGCTACCTACCTCTTCAAAGAA
AATTCCACAATCTGACATTTGAAAGAGTCATCTAAATTAATTGTATGTTTTTAGGGAAAG
GAATTTCTTAAAACCTAGTAAATTTAAATTAAAAAATAAAACCTAAGAAATAAAAGGGAG
TTAAGGCATCAAGAGAATTACAGCTAAACATGAATTTTACAAACAGTTTAAACAGAGACA
TCCAGAGGGATAAACAACAGAAATGTGGGTAAAGGAGACAGCAGTGTAAAATATGAAAAC
AATAATAATTTATAATGTATCAAGGGGCCATGAGGGTGGGGTGCGGGGAGGGAGGAAAAA
ATAGGAGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATCTATTTTCACATCAACATGC
AAGCTAAATGAGTAAGTATTATGCATATTTTATCTGGCCCTTATAAGTTACACTTTAGGT
TTGGGAAATTCAATCAAAAACCATTTGAAAGGAAGCCTCAGAACAAAGTTCCTTAAAATT
AAAACGAAGTACTTCACGCCAGTGTGGTCATCTCCAAACATAAGGCATTACGTATGTGCC
TTTCTCTCTCATTTCTACACAACATTAAACACATGGCTATCACCCTGCAGTTCCCTTTCC
CATTGGATCAAAACACTGGTCTGGGTGGTGGTAAAAGGAGGAAAAGAAACATTGAAGCTG
GCCTTCGGTGCTCTTGGAGCTCAGCTAGTTTCAAACAAGGTAAAGAAAAAAACCAAACAT
GGCTATCTTGCTTAAATACACAATAAATGCCTTCTGAATACAAGTGAGATTTTTACAGTG
GCACAGTTTATAAGAAGAGAAATTATTGTTTTAAAAGGTGTTAATAGGGGGAGGGAAGAT
AAAAAGAGGAGCTGACACCAAGGGCTCAAACAGAAAGTAAATGTTTAGAAAACGGTGATG
GCAACAAATGTACAAATATGCTTGATACATTTGATGTATGGAATGTTGTAAGAGCTGTAA
GAGCCCCCAATTAAAAAAAAAGTGTTAACACGGATATAAGAAAACTTAAATTAAACTACA
TTTACTTACTTTCTGATACTGTATAAAGGAGGTTCTGGGGTAAAGGAGGAGGTAGTCTTG
CTCCCACTGGTGCAAGATTGGGCACTGCACTTGTCCCAGGCTGCTCACGGTTGTTTATCA
TGTTTGACTGTGTTATGGGTGGTCCTACAGATAACAAAAGTTAAAGGGAGAGTATTATTA
TTTCATAGCTACTAAAGATATTTTATTAGCACTAATTTGAAAATTCTTACTTCAAAAATC
TTTGACTTTGAACAGAATTAAAGAATTTTATGTGTGCAGGTTTAAAGTACTTTAAAATGC
ATTATTAATTAAAAGGTAAAACTAATTTAGGGTAAAAAAAAAATCAGAACTGGCTGACTC
TATAGAGTAGAGGTGGAGAATGGCCGAGAGAAAGCTTACAAAAACTTTCTGGGTTAATAG
TAATGCTCTACAGAAGTCTTCTTAAGTTATGCCAGCTGAATGTACTGATATGATGACTGT
AAATAGCCTATGAAATGCACCAAAATAAAAATGGAGATGGGAAGATATGTGACAAAATGT
TAATTGTAGAACTAGGTGGTAGATACAGGCATACCTAATTTTATTGCACTTCATCTTATT
GTACTTTACAAAGATTGTTTTTTACAAATTAAAGTTTTGTGGCAACTCTGTTAGCAAGTC
TACCTGTGCCATTTCCCTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved