Echinops_telfairi Locus Mono:522:SNORA42
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:522:SNORA42
Echinops_telfairi
Mono:522:SNORA42
GeneScaffold_8197
SNORA42
1001..1133
2133
TTCCCATTGGGCCAGACACTTGGAAATAACGGAAGATACGTCCATGAAAAGTAGGGAAC
AGACGCATCGGTTGAATATTCTTTCACCTTGTCTCCTCAAAACGCAAATACAATAAACGA
TGACCTAGTTCTTTTCTTTTCAATGCTTGGAGACTGGGATCTTACAGAGAACTTCTGCCT
AGCACACAGGGAAGAGTACCAGCGCTTGTCCTCTGGAACAACAATGAGCTTGTGAGCTCA
AAGAGTGTACCTTCAGATCCTCCTCCCATGTGTTCAGAAGGTCACTTAACAAAATGCGGA
TTCAAAGGGAAAGATCTGAGGGCGCTGGCAATGCTGTGAAGTACTGTCAAGTCGGTTCTG
AATCCTAAGGACGCTGATTTACAGCCAAAAGTGTCCCTGCCTGGCCCTGTGCCACGCTCA
CGGTCATTACGATGCCCGAATTCCATGTTGCAGTCACTCATCACCTCTCGTTGACAGTCT
TGATCTCCTTGGCTGGCCTTCTGTTTCACCTTCTCCAGGGAAGGGTCTGTTCTATTTGAT
CCTCACACCTAAGGCATTCTGGCTGTACAAGGTACGGGGTCTGATGGAGCCAGACATGGT
CTAGGTGATAGACCGAACCGCTGTTCATGCATTTATTGTGCGGCCCATTGGGACCAGGAA
TTCAGATTCTTTGACACCAGTTGCGTCTGGTGGATAGAGCAGGGGCATGGTGACCACAGG
GAGTCTTCCTTCTAGAAAAAAGCAAACCCTGCGGGGTGACCAAGGGCTGCAGCCACTCCA
CCCGTGTACCCAGTGTGCCTGAACTAATGCCTGTGCTTCTGGCTGATGTGCTGCTCCACA
AATAAGGGAGTGCAGCCTTCAGTTTACGACGAGGACTCTCAGAATTAGACCGCTGGGATG
ACATCAGTACGCACTTGCCAGACAACTCAGCCGCTTTGAGAGATGCCGGCAGTCTTAGTC
TAAGAGCTGAAATGATGTGGCCTACAGAAGAAGAATTGGGGCCATGTATTTGGATGTATG
GCATGCCATCCCCGTGGGTCTCATAGCGCCCCATGGCAGAGAAAAGTATCACCCTGAACC
ATTGCCTGGCCTTGTTGCCCGCAGGCTGCAGGCTCTGAAGCAGGTAGCCCTGTGGGGAAA
AAACAAAACAAAACAAAAACGGTAAGCAGTTCTTGTGCGGATGATGCAATTTGAAGCCAA
TTTAGATTTTTTTTTTCATTCCAAACCAGCAACTTACTGTTATTTCCAGAACACATCATT
TCCTCAAATTTCTACCAATTACGGATAACATCTTTAGATGGCTTACAGAGAGGAAAAACC
AGAAGTTGGTAGTGAGCTCGTGTTTCCAACGGAAGTCTTACAATGTGACGGGTCAGTGAT
GTCAACTGCATTGTCCAGACAGGCAGGTGTCAGGTGTGGAGGTCGCACACGGGGTCTTCA
GGTGGATCCAGGACAAGGCTCTCCAGGTGCACTGGATCGCACCGCACCCGTGTCTCCCAC
TCTAAGACTTTCTTCTAGCAATCACCATGCACCTTATAGGCATCATTAATTTTTTTGCCT
TATTGGAGATTAATCTTATCTTAAAAAACAAATAGAAATCTCTTGTCTTCAACCACCTAC
CCTTTTCTCCTTCCCTTAGAAGTCATTAAAGGATTTGTATATGTATGTAAACATTGGGTC
TAATTCTTTGCTCCTGTTCATTCCTGAACCCATTCTAGCCAAGCTCTTACCCCATTACTC
CATTCTAATTGCTTGGATGATAGTCACTAATGCTCTTTTCATTAATGGTAATTTCTTGGC
TTTCATCGCTTGCCCTGACAACAGCAAATGTCTCGGTTTTTAAATTTTTATATCACAGAC
TCTGGCTTTCCTGGCTCCTCTTCAATTCCCTCAACTCTAAAGAGAAGATTCTCATCTCAG
TCCTTGAAATGTCCATCTCCATGTCCATGTTGCATTTTTTATGACACCCAGTCTCGTGGC
ATTAGATGCTATGGTTCCCCAATTATAGGTACAATCTGATCACTCACCAGAATTCCAATT
GTATTCACTCAATTGCCTAATTGATAACTCCAGTAGGAAATATTTTAGGTATTATCACCA
AACACGTGTAAAGAGATGCCTTTCCCATATATTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved