Echinops_telfairi Locus Mono:398:SNORA73
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:398:SNORA73
Echinops_telfairi
Mono:398:SNORA73
scaffold_252640
SNORA73
1001..1207
2207
GGACAGATGATTCCTTAAGGACCAGTGGTGAGAGTGATGATACCGGGAGGGTGGAGGGA
GGGTGGGGTAGAAAGGGGGAAGCGATTATAAGGATCTACAGATAACCTCCCTCCCTGGGG
GATGGACAACAGAAAAGTGGGTGAAGGGAGACGTTGGACAGTATAAGATAAAAATAATAA
TTTATAAATTATCAAGGGTTCATGAGGGAAGAGGGAGGGGGGAAGGAGGGGGTAAAATGA
GGAGCTGATGCCAGGGGCTTAAGTGGAGAGCAAATGGTTTGAGAATATTGAGGGGCANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTTGAAATGATGATGACAATATATGTACAAGTGTGCTTGACACAATGGATGGATGGAT
TGTGATAAGAGCTGTAAGAGTCCCCAATAAAATGACTGCTAACCTAAAGGCCAGTGATTT
GAACCCACCAGCCACTCTTTGTAAGAAATGATTGAGTGATCTACTCTCTAAACAACTACA
CCACCCGGGGCTCCTTACTCAATGAAAAAGTCTCAAAATGCACAAATAAACTTTAAGAGA
ATTGAAAAGAGAAAGAGACAACACAACAATAAGTGTCTTTATTATACCACATTCAATAAA
AATCGAACAACGCAATCATCTAACTTGACCTCGTGGACACATACAGAATATGCTATTAAA
CAGTAGCACACTCTCTCCTGTGCACATGGAATATTCTTTAGGAGAGACCACATATCAGGC
CACAAAGCAAACCTCAATACATTTAAAAATATAGAAGTCCTACAAAGCATCTTCTCAGAT
CATAAGCCTATGAAAAAAATTAGAAATCAATGCCAGGAGGATCATAGGGGAAAAGTAAAT
ACATAGAAACTGAGTAACACTCTTTAAAAATGAATGGATCCCCGACTCGGATCCTCCCAG
GAGGTCACTCTCCCCAGGCTCTGTCCAGGTGGCAGAGGGAAGCGTAGGGCTCTGCCCCAT
GATCACAGTCCTTTTCCACAGCGTCCTAGGTAAAGTGGGGCCTTGCGTCTGTGCCTGCAT
GTTCCTACAGCGTCTCAGAGTCCTGTGGGCAGTGACTGAGGAGACAGCCCTCCATGCAGG
ACCAGCCCTCTAATACACCCCGACAGAATGTAGGCTCTGTTTTATGATGAGTTAGACTTG
TTTTCCACTTGTAATTTTCTGCAGAAAACTAATAATGAAGTAAAATAGCTTGGTGTTGAA
AGAAAAAAAACTAATGGATAATGAAAGAAATCTTTTAAAATACATGTAGTGAATTAAATG
AGACTGAAAACATAACAGCAAAAATCTTTGTGACACAGCAAATACAACATTCCTTGGACC
AAATCAAAACCACAGATCACTAGCACTGGGGTGATTCTGCCACATAGCAACCCTGTAAAA
CAGACTAGAACTGCTCTTGGGTCTCTGAGATTGTAATTCTTTAAATATTGGGGTCCAGAC
ACCAGGTGATTCTTCTTCCCTGGTAGCTCTTACTATGCTGTGTTCGTGGGATTTTAATGG
AGCCTTTAATAGTGCTCTGAGTTCATCATTGGGCTACTGACCACAGGTTCAAACTCATCA
GCCACTTCTCAGGAGAAAGAGGAGGATTTCTACTCTCTTTAAAGAGTTACCGTCTCAGGA
ACTTTGTATTCCTGATTGACTCAATGACAGTAGGTTTGTTTTGGTTTTAGAGGGATTTAG
GGAAACTTTGGGATGACATGGGGCCCTAAGACTAGTGAGTATGTATTGGGCTTCTAACTA
TAAGGTTAGCAGTTTGAAATCACCAGTGGCTCCACAAGAGAAAGATGAGGATTTCGCTAC
TCCTGTAAAGATCTACAGTCTTGGAAACCCACAGGGGCGATTCCACACTGTCCTATGGTC
TTTGTTAGTAGGAATCGACTTGATGGCAGTGAGTTTGGGATTGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTACAATGACTAAGTGTTCAACTGCTAACCTAAAGGCCAGTG
ATTTGAACCCACCAGTCACTGTGTAAAAAAGACCCAGTGATCTACTCTCTAAACAATCAC
AGCCTAGGAAACACTTAAGTGCAATTCTATTCTGTCCCATAGAATCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved