Echinops_telfairi Locus Mono:110:SNORA36
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:110:SNORA36
Echinops_telfairi
Mono:110:SNORA36
scaffold_319200
SNORA36
1001..1126
2126
ACTATTATGAAAATTGTGCTAATTAGCACATTCAACAGAGAATGTAAATAAAATCCAAA
GTAATAAATTTGGGAAAAGCAAGTCATGGGGTGATATAATGTTTGTTGTGCGGTGGTGTC
GGACAGATGCTTTTTAAAAATTACCTTTCATTACCTGCTGTTGGGGTGTGGTGTGGTACA
CTGACGATAATTTTGATCCACCCCCGAAGCGGGTGATGGCACACCCGCACCATTTTGAGG
GGGCCCTTTTTGTATTTAAGACAAACCTACTCTTCATTGTGGGTTAATGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCATTGTAAAATAATGGCATACACATTT
TTAAAAAGAATCAATTAGGACAAAAGTGGCAAAATAAAACCTGCTAGGCTGCAAATTGTT
TTAAGTCAATGGTAAGAGAGATAATGAAGAATTGATAGCAGAATCAAAATCACTATGAAA
TGACTCATTTTGATTTGAGTGACTTCAAATATAATATTCAAGTTTGGGACCTTAGGTGCC
ACATGATAATTGTTTCTGCCATTTAAAATAAACTGCTTCTCAAAACATGTAGGAAAAACT
GAGAATTAGTCTTTGCCCTGAAATGTCAGTAAACTTAAGTCTAATTGTATTGTATTGCTC
CTGAGAGAAAATTATCTATCTTATCTGTCACATCATTCTTAGATTTTTAACCTCCTGGCC
TATCATTTATCTTCACTCCTCACTGAACAGTCAGTTATTATAACCCTTCACCATAATCTT
CATTTAACTTGATTTAATTTGCATTGTGTTCAGGATTTTTTCCCTTGCTATCATTTTATT
TTCTTCCTTTTAAATTTTATTTTCCTCTCATGCAAAACGTATATTAAAAGAAAATCACTA
AATATTACCATATCTTCAAACAAGCTACCCCAGACACTTTATACAACAGAAATAACCGTA
GTCTAAGAATATAATTTGATAATTAAACTTTTGGACATTAAAACAGGCTTGGGAAAATGA
CTGGGTAGAAAATATTATTCTATTCACTTTGTTCCCAGCCTACATTTAAAAAATACATAT
ATATATAATTTGAGACCCGGTGTCATAGGGGCACAGGTTGTTTTCCTCTGGGAGAAAGAT
AAAGTTGTTGGCTCTTGTAGAGATGGTTTTGTTGTTAGGTGCCATTGAGTTGGATCTGAC
TCATAGCGATCCTATGCACAACCATAATGAAACATTGCCTGGCCATCCTCACAAGTATCA
CTGTGTTTGAGCCTATTATTGTAGGCACAGTGTGGATCCATCTCAGGAAGAGTCTTCTTA
TTTTTGCTGACCTCTATTTTACCAAGCATGCTGTCCATTTTGGGTACAGGTCCTTTCTAA
TAATGGCTTCATAAACTCGATGGTGGAGTTCTATTCTGTCCTATAGTATTACTATGTGTG
GGAAACAATTTGATGGCAGTGGGTTTCCTTGTTGTTTTTTAAGACTGTCATTTATTACTC
TATTCTCCCAGAAAAATAAGTATATAATTCTAGGCATCAATTATTAGCCATTGGCTAACT
TTCTGTATAACATTTTCCTATATATAGTGCTACTACAGTGCTACTATATATGCTTAAAAA
TTAACTTCCTTATAACAGTAGACTAAAAGACAAGTTTAAAATAGATTGTAAAATGAGATT
AAAATGTGATTTATTAATTTCCTACTGCTGCTGTAGCAAATCATCATAAACCTAATAGTT
TAAAACAACTCAAATTTATTCTACTGCAGTCTGGAAGTCAGAAAATCCAAAGTAAGTTTC
ACTGGGTTAAAAATCAAGGTGTCAACAGGACTGACTTCCTTCTGGAGACTCTAAAGGAAA
CTCACTCTCATTGCTCTTTTCCAGAGATGCTGTTCAGATCCCTTGGCTTCTGGCCCTGAA
TCATTCTAACCTTTGCTTCAATCATGACATCTTCTCTTACTCTGACTTGTGTGTCTTCCT
TTGTCTTATGAGGGCTCTTGTGATTATCTCGGGGGTCCTTTACTCTGCCTACCTTAGTGG
CCCAATATATGCNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved