Echinops_telfairi Locus Poly:1:SNORA63
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Poly:1:SNORA63
Echinops_telfairi
Poly:1:SNORA63
scaffold_311367
SNORA63, SNORA63
1001..1128, 3200..3327
4327
CACCTACCACTTATTTCTTTTCTTTTAAGTTTTTCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GGGACAACAATATTTCTTCCCTTATATATGTTTTTTTTCAATCCCCAAGCATACAGACGG
CATCGGATGATTATGGCTATGGAGCTTACTAGATCCCATATCACACTAATAGGTTTCTGA
GATTTGAGCTATTTAGTCTGCCCAGCCAGCACCAGAAAACAGTTTAGCAGTGTCAGAAGC
ACTATGATCTGCTCCACATAGTTATCGCTACGCAGAGGGCCCAATAGAGTCCAACCTACA
ATTGTCTTAAGTAATAATAATAAAAGAAAGAGGAAAGAAAAAGACATGTTTCTACAATAT
AGCTGTTAAGTGCTATTTTGTCGTTCCCCTGCTCAAAGTAAAGTTGGTTCTTATCTATCC
CTGTCTGCTAGTTTCTTGTAGCAACCCAGGGTCTCATACATTAAAAAAAAAAAGACACAT
TTCTTTGCTTCCACACAAAAAAGGGAGGTTTTCTGACTAGGGACACAGTTGAAGACCCCA
GATAGAATGAGAGAAAAATGTAGACCGAAACTTAAATTCTTAAAAACGGGCCAGAGGAAC
TAAGTCAGTAGAGACTTCAGGAATCCCCAAACTCAGCCCGAGGCCACCTGTTGCGGGCAC
CTGTAGTTCAAAAGGTTGAATGTATTACCTACAGCGGGGTGCCAGGGGTGTCTCAGGATG
AGGGTGCCAGAAAGGCCCTGACACAGGCTTTGCTTAAGTCATTTAAAGGCAGGTCTAAGG
GAGTGTGTGTTGGCTGTCCATTAGAGGATGCCCAAAGGGATGGGCAAGTCTATGACTGGG
TATGTTTCCTGGGTAAGACAGTGGCTTTGTTTTAGTGCCTACACAAGAATGATGAAGCGG
CCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTCTATGCTAGTGCT
TCTTACCTGAACAAGCGCCCCATTCCTAGAAAGCTCGGCTTGAAGCCATCCTGCCTATAA
GATGTTGTTCTTTACCATCAAGTCAGAATGAAACATGGCCCTGTCCTGAACCATCTCTGT
CATCCTTGGCAGGCTTGAGTCCCCTGTTGCAGCCCCTGTATATTTTGAGTAGCTTCTAAC
TTAGGAGGTTCATTTTCCAGCACTATAGTGGACAGTGTTCTGTTGTGATTCAGAGGGTTT
TGCATGACTGATTTTTGGAGTGCCAGGCCTTTCTTCTGAGCCTCAGTCCTGAAACTCTGT
GGGAAGATATTCACCATGGGTGACACTGGTGATATTTGACACAGATGTGTCTTGCAAGAA
GTACAACCAGAATGCTTCTTAAAGGAAAAGATGGCAAGACTTCCTCTCGTGTACTTTGGA
CATGTCAGAAGAGACCAGTCCTCGACGAAAGACATCGTGCTTGGTAAAACTGAGGAGCAG
CGAAAAAGAGGAAGGCCGTCGAGGAGATGCATGGACACAATGGCCGCCTCAGTGGGCTCC
AACGTAAGAACAATTCTAAAGATGACACCAGACCACACCATGTTTCCTTCTGTTGTCCAC
AGGGTCCCTATGAATCAGAACGGACTCTATGGCACCTGACAGCCACAACAACAGCTTCTA
TCCTGCCTATAAGATGTTGTTCTTTACCATCTTACTGCATCATCACAACTACACACAAGT
CACCGAAGGGTGACAAATTGACTGATGACTAGTGGGCTTTCAAACAACCAAAAAAAGCTT
AAATACCTTTTAATTATTGAAAAATGGAGAGCCCTCAAAATGTGTCATTTCAGAACTTTT
CATGTGTATTGTTCAGTGAGACCAGTTACATCAATCGTGCCGTGTAACCAACGGGCAGTG
AACTTTTAAGATACAGTCTTTCTGAAACTTGTCTGAATGTTGGAAGTCACTTGCTAACTC
ATTTCTAAAATTCCTAGCTTTTTTCTCTGAACAACATTGGTTTTAGCCATTCACTATTTG
TCATTCCTCCTTCCTACTGCAGTGCAGAAAAGAGATACTGATTAAAAGTCAAAACCACAC
ACCTTGTCTAGTCACGTTTTACAAGCCAAGTTGTGGAACCGTGAACTTGATGAATTCTGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCAGTACAGGACAC
ATATTCTTCCCTATATGTTTTCTTCCATCCCAGCATACAGACGCATCGATGAATATGGCT
ATGGAGCTTACTAGATCCCTATCACACTATAGGTTTCTGAGATTTGAGCTATTTAGTCTG
CCAGCCAGCACCAGAAAACAGTTTAGCAGTGTCAGAAGCACTATGATCTGCTCCACATAG
TTATCGCTACGCAGAGGGCCCAATAGAGTCCAACCTACAATTGTCTTAAGTAATAATAAT
AAAAGAAAGAGGAAAGAAAAAGACATGTTTCTACAATATAGCTGTTAAGTGCTATTTTGT
CGTTCCCCTGCTCAAAGTAAAGTTGGTTCTTATCTATCCCTGTCTGCTAGTTTCTTGTAG
CAACCCAGGGTCTCATACATTAAAAAAAAAAAGACACATTTCTTTGCTTCCACACAAAAA
AGGGAGGTTTTCTGACTAGGGACACAGTTGAAGACCCCAGATAGAATGAGAGAAAAATGT
AGACCGAAACTTAAATTCTTAAAAACGGGCCAGAGGAACTAAGTCAGTAGAGACTTCAGG
AATCCCCAAACTCAGCCCGAGGCCACCTGTTGCGGGCACCTGTAGTTCAAAAGGTTGAAT
GTATTACCTACAGCGGGGTGCCAGGGGTGTCTCAGGATGAGGGTGCCAGAAAGGCCCTGA
CACAGGCTTTGCTTAAGTCATTTAAAGGCAGGTCTAAGGGAGTGTGTGTTGGCTGTCCAT
TAGAGGATGCCCAAAGGGATGGGCAAGTCTATGACTGGGTATGTTTCCTGGGTAAGACAG
TGGCTTTGTTTTAGTGCCTACACAAGAATGATGAAGCGGCCTTGTTTTCTTTCGTTTATT
CTGGCCTCAGGGTAAGCTGGTCTGAGGTTGAGGTTGGCATTTGTGAGGCTATTTCTAAGA
GGAGGACCCAATTGGCTATGAGTGTCAGACGAGTTTGTAAGAATATTGAAGGCTTGCTTT
GAACCTCCCCCACGCCCCCACCCCTTCCTTCCCAGAGGTCATTCTGAATCATGTCAAGTA
TCAAAGAGTAAAGCCAAGACTCACTCATGGAACTTGACCTTGGATACAGTGGTCACGAGG
ATAAAATGAAAGCAAGGAGACCTCACAAGTAGGTGACCAAGAGATCTTGAGAGTAGTACC
AGATTCTTATTGAGTATAATTTTCAGTAGAATAAAAAGAGGCATTGTGTGTTTAAGGAAA
CAACCCTTCGAACCAGCGTCTTTTATTTTATTGCCTCTGGGCTATTTATGGAGCCCTGGT
GGTGTAGTGGTTATGCCTTGGGTTACAAACTGCCAAGTTGGCGATTTAAAACCATCAGCA
GCCCCGCAGGAGAGAGATAGGGTTTTTTCTCTGGTAAACAGTTACAGTACAGTGGGTTGG
GGGCGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved