Echinops_telfairi Locus Poly:4:SNORA43
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Poly:4:SNORA43
Echinops_telfairi
Poly:4:SNORA43
GeneScaffold_6235
SNORA17, SNORA43
1001..1130, 1546..1663
2663
GGGCACACTGTCTGAGATAGTTTATTGTGCCAGCCTGGCCGATAAACACAAGTGGGATT
GACTGAAGGGCAGAGAGATAAATGCCTTGGTGAGTCTCGCCTTTCTTGTCTCTCGCTCTT
TGATCATCCGACCAGTGTGCGGCTGCCTTGCTTGTCCTGTGCCTCAATTTAAAGGCTACC
CTACTGTATTAGTCTAGGTACTTTGGAGAAACAAATCCACAGCAACTCATGTATAAGAGA
GAGTTTTATGTAAAGAAAATGTGCATCACGAAAACATCCCAACCCAATGCTGCCCAAGCC
CACAAGTCCAACATTAACCCATACCCAGCACCAGTCGCGCGTGCCCCAAGCCCCTGGACC
TGGAGGAGCGACAGGTGAGGACCCGCAGGTAAGTTACGAGGCGGCCCTACCGGGAGCGCC
CGCCAGGGGCGCTGCGGGGCGGCAGCTGGGCGGGGCGGACTCCAGGCCGGCGCGGATTGG
CCCTCGCGGGCTGCCGTACGGCCTATAAAAGCCGCAACGCGTCCTCCCTCGTCCTTTCCG
GGCAGCGCGGGCGGCTGCCTTGCTGACTACGCCCGCCCTCCGGCGTGGCGGCTGCTCCCC
CGGTGGCTGTGGGGGTTGAGGACGCCCCTCCGCACCCCGGGGCCCCCGCTTGCCGCGTCC
TTGGGGGCTCCGGCCCGTCGAGGGCCCGGGGACACGCGGCCACCGAGTCCTGGCGGGTCT
GCACCCCGCGAGGGCCGCTCCGCCGGGCAGGGACGAGCTTGCTACTGAAGAATGACGCCA
CGGCTTGACGGCCACTCTGCCCCGGGGTCCGCCCCCCATCCAGATGGGCCGAGAACTGCG
GGGCAGGCGAGTTGCCTGGCCGGGGGTCTTCTTAGAATGACCGTGCGGGCTGCGGCCCGG
ACCCACCGCCACCATTGTGTTCCAGGAGACAGGGGCAGTGACGGCTGCTTGCCGGGGCCC
TTGGGTGAGTGGCAGCCTCCCGGTGCCGGGTCCACTCACACACTGCCCCTAGAGGCGTTG
CAGCGCGGCCACCCTGCCACAGCTGTGTCATTAGAGGGCAAAGAGAAGAGGGGCTATGTC
TAGGCTCAGGGGTCTCACGTGAACCACCTGACTGACTGCTAGCCCCACAGTCCTATTGCA
CCGGTGTGACCTGGGGAACCTGAAGGGTGTGGGGGAGGCGGGTTCCCTGCTAACTCATTT
TGCAAAGTGACAAGATCCTGGCAGCTGGATGACAGGTGATGGGCACCATTGTCTTTTGCG
GGCAGGGCACCTGAAAGGTGTCGCTGCCCACTGTAGGGGGGTCCGAGCAAGCCCATGCAT
AACGGTGACTTGGGAAGGGGCTGGCTTGCCCACAGCTGACTGGTTGCCTTGTCCCCCCTG
TTTAGTGCAAGCCCTCAGCCGGTTAATTTAATGCATGAAGGCAGGTGATGTCCCGTCGTG
GGCACTGGCCACAGTCACTGACCACCACCATTCTGCCAAGACTCAGCCGCAGACCATGGT
AAGGAAGGCGGGTCCCAGGCCCCGGTGGGGGTGGGGCTGCCCTGGACCGGCCAGCACCAG
GCATGGCACTCTGCTGTGCCTGTGGTAGGCCGAGAGGAAGTGGCTGTTTCTACACTCAGT
GCCCCCACCCGTGGGCACTAAGAATGGTTTATAGCCTGACATTCCCCTCGGGGGTGAGGG
TGACTTTCACAGGGTGTTCAATGTTCTTAACAGCCCCTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATCCCCATAAACTGACAGTGG
CTGCCAGGGCTCCTGTGCTGCTAGACTACAGTACAAGCTGAGTTGGCTGAGTCCTTGCCC
TTCCCCTCCCTCCTTGGAACTGAGAGCTGTTCCTGGCAGAGGCCTCATGCTGAGCAGCGA
GACGTTTTCATGAGGTCACCTCCAGCACTAGAGGTAGCAGAGGCTGCACGAGTGGCCAGC
TAAACCGCTGCCCAGAGAGTGCCTGGCCCTCCCGCACCAACTAGGAGTACTTGGTGTGAG
AGATCTCCTTCCAGAGCAGTGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved