Echinops_telfairi Locus Poly:2:SNORD113
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Poly:2:SNORD113
Echinops_telfairi
Poly:2:SNORD113
scaffold_324868
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1075, 1731..1805, 2490..2564, 3184..3258, 4586..4660
5660
CTTTCTACCCCCGTACAAAAGTTCCCGTCTTAGAAACCCACAGGGGCCGTTCTGAGCCT
GCAAGGCTGATGAGCCAGCATGGCCTTGATGGCTGAGTTTGTTTGCTTGGCTTTGGTATG
AGTTTTGAGAGAGGAGCACATGAGCATATAGAGAAAGATGAGGCTGTCTACTCCCGTAAG
GATTTTTTTTAAGTCTTAGAAACCCAAAGAGGTGGTTCTACTCCGTCCTATAGGCTTGCT
GGTCGGAATCCAAAACTTATATCCCAAGGCACCCACTTTGGTCCAGTGATGACGAGTGAT
GGTTTCTGCAACTCTCGGAGCCAACACAGAGAGATGTAGCCCTACGTGGAAATGATAATG
AATATTAGGAATATTAATGGATCTGGTACATCGCCTTTTATGACTTAGCTGTTTTGTTGA
ATATGATATTAAAGTCGATGGATGTATTCCATTGAAAATACGCAAATCAATACAATCAAT
ACACTATAAACGGTGGCACATAGTCCAGTTCTAAATGAATATGACAAAGCAAAGAATACT
CTCTTCGTATCTTGAACCCCAGCATTCTTAGAACTAGAGCATTTCTAGAGCAGAGGAGTT
ACTGTTTTGACTAAAGGTCACCTGGACAGCCCAACTCCAACTCCAACGTTCTTGTCCTTG
GAGAAGTCGCCCTGAGTGTGGTTCCGATCAGCATTGCCCAGGGCCCCATCACCCACTAAA
CGCATGAGCAATGAAAGGTGGTCAGTTCTGAAAAATGCCTCAGTATGTGTATCCTCTGCT
CTACACCCCTCAGGAAGGATGCTCTGGGCTGAGGTCGGTGTCTGCAGGGATCGTGTGCAA
GACCTTGATGGCATGCGTGAGAAACAGGGGAATTGATGTGAGTAGCAATGAAAAATTGTG
TGTTAATTACGTATCTCCGATTTCTTAATTTTTATTATGTTGTTGCGGAAGTCATCCCTT
ACAAGGTGTGTGTTTTGCAAGAAGAAAGCCAGGGCTAATCCTGGACCAATGATGACAACC
ATTGCCATCCGAGTCACGGACGATGAACAGTTTGTGTCTGGAAGTCTGAGGTCCCAAGCA
ATGAAAGACCTGGTCTCTTCTCTATGTTAAAAGGATTGTATGCACAGGAGGATTTAAGGG
GCTTTTGTACGTGACTGTTATAAAAACAAAATACATAGAAGTATGCATCAGAAATATTCC
GTTGATAAGAACGTCTGAATGTCAAAGCATCTTCGGTCTCTAAAGGCACAGGGCAGAGCA
AAGAATGCCCTTTTCCTAGACCCCAGCCCTACCTTCCTTAAGAATGGTACTCATGAGGGG
TGGGAAGTGGTTCCCTCTTTGGCCAAGAATCATTGGGACCTTCCTTCTCAGAGCCCACAG
GCTCACACTTGGTGGCATAGTGCCAGATAGTATTATTCTTACGAGAAGAGATGCCAGCAT
TACTCAGGGCCGGTCAGTCCCCTCCAGAACACGAAAACTGACATGTGGAGAGTCCCGATC
GATGGAAAGAATACCTCCATGTTTGTACCCTCTTTTCACCTCAGGAGGATGTCAGTCCCT
GCCACTCGTCGACCATGGACTCCATGTGTGGAGAGCACTGGATCTATGTGAGTCAAAGAC
AATGCTCTTGTCTTAATGGGGGGAGGTTGTGTGTCCCCTTAGGTGTTTTTTTATGATGAT
GATGGTTACTTAATTAATGATGCCATCAGAGTAGAGGTATGCAAAGAACACTGGACCAAC
GATGCCCACCGGTGGCGTCTGAGGCACAGACGATGAGCAGTCCGCGCGTGGGACTGGGAC
GTCCAGTGCAGAGGGACACCTCAGCCTTTGCTTTGGGGCTAAATGGGCCCATGGACCAAG
AGTACTTATTTCCCTGGGCTGGTGGCTCCCTCTTCATGCAATAATATTTCTCAGAATCAA
TGGACTTATCCACAGGTATCATGGAAAGTATTAAAAAATGGGAATGTGGAACCCTGGTAA
CAATGACAAATGCATCTAGCCAGGCCTCAGAAATGCTTATTATCTATTGAAACCCTCCAA
AGCCCATTTCAGGAAAGTGACCTTCCAGGAGGGCCCTGCTCCGGCTAAGGACCCTGTAAG
CAGTGTAGCTGCAGTCATGTTCTTTCTCTGGTTGGTGGCCAGCCCAGGTTGGTCAGTCAC
TCGAGAGGAGACAAACAGCCGCTCTAGCCAGTAGTTAGCTAAATGCAGGAGTAAGGGCAG
GTGGAAGGGACCGTCACTAAAGCTAACGTGTCGTCTTTCATCATTCTCTCTCTTCCACAC
CCTTCAGGACAACAGTGGTGCGCTTCCCACCAGGGTCTCCAGCTTGCAGTTGGCTCTCAG
TGTCAGAAGCGTGGACACCTAGGGGAGTCACTGTCACACGCCCTCCCTTGGTGTGAGTGG
TTTGTGCGCCTTTTTTGGTATCGTCCCCTCCCCCTGGGTCTCAGTCAGCTGGTGAGTGCA
TAGCAGCAGATGACAAACGAGAGGCTAATCCGGACCAATGTCGATCAGCGATGAGATCTG
AATCGTGGACAGTGACTAGTGTGTGTCTGGAACTCTGAGGTCCAATCCAGAGGGACAATG
TCAGAAGTACTAATCCTGGCAACAGATGTCAGAAGATCTGGTGCTTCCCCTTTGATGACT
AAGGAGTTTTGACTAGGATCTTATTGAAAAATAGATGGAAGTATCCATTGATCATAATGG
AATCCATAGGAATATGGGTGAAGCATCTTTCAAATTTACATATATATGACAAATCCAGGA
GTGCTTTGAGCACATATCATACAAATGGTGTCATATCGAGGTGGAGGATGCTTGCTTCTT
TGGCTGAGGCTCATGGGGAAAGTAAAATTCAAAGTCCTTGATCTCGTCCTTGGTGGCGGT
ATGTGAGGAGTTGCGAGCATTCTCAGAGAAGAAGTCAACACTACCTAGAGTCGGTCATCT
CTTAAGAGTGTGAGGAAGGAAGGTGGAATGTTCCACAACCAACTGAGACTGTGTCTCAAT
ATTTGTATTCTCTGCTCTGGCTTCTCCCCCTTCAGGATGGCTCTCCGGGATGATTTCATT
TCTGCCATGTTCACATGCAGGGCAACTGACCTCATGAGTTGGGAGAATAAAAATCGATGT
AAGTAACAGTCAAAGGTCTTGTCTGAATCAATAGCAATAGGTGGATGTGAAGGAAGGCCA
ATTCTGGACCAATGATGACCACTGGTGGCGTCTGAGTCATGGACAATGAACAGAACGCGT
GTGGAACTCTGAAGTCCTATCCAAAGGAAATCCCGCCCCTCCCCCAGTAGGAAATGGTGT
TGCAACCAGAGACTAGCAAGTTCCTTGGAACATCTTCAAAAATCAGCGAAAGTGTCCCCA
CAAATCATGAAATAAATAAAGCTGGAAAAGTGGAAGACTTGGCCAATGACAGATGCATAC
AGAGGGCCCAGAAGTAGTACTTGTTGAGGCCTAAAAGCCCATTTAAAGGAAGGTGCCATT
CTAAGGGGTTTCTTCTATGGCCGAGAGCCATATAGGCGATGTAACCCGAGCCTTTCCCCA
CCATGCCATTCCAGTCTACGGGGGAAGAATTAGACAGGTCGCCCAGTCCGTTATTAACTG
AATGCATGAATAAGGGCGGGTGGAAGAGACCCCCAAGTCAGTTATGATGTTAAGCCTTCT
ATCATCTGCTCTGGTTGTACCTTTCAGGAGGGTGGTTCCCAAGGTGATGGAGCTCTCTGC
CAGGTTCTTCAGCTCAGTGACTGGCTCTTGGTGTCGAGGAGGATGGACATGATGTGAGTA
CAGCAGTAAAGCATCCTGTCTTGTTGTGGGTGGTAATTCCTCAGGGGTGCCAGTTAAAAG
TTGAATTCACCAATAAGAAGGTGTCAGGGCAAAATAAGAAACTGCAGGTCAATTCTGGAC
TACTGCTGACCGGTGGAAGCGATGAATAATGTGTGTCTACAACAAGCCTGAGAACAGACT
CCGATGTGGACCCTTGCCATCGTTCAGAGTGTTTATAGAGAGAGGTTGGATAGATCTAAG
GCTGTGGGGCTTTTCTTTTTATCATTAATGACTTTAGTGTAATATCAAGATTCAACGGAC
ATTTCCATTGAAAAGAATTAAATTCATAGGAATAAAGAGGGTGGGGCAACGTTCAACTCT
ACACATGTGTAGAAAATCAAGGCGGACTTGCTTTGTATGTCAGAAACCGTAAGAAGGGTA
TCGTTTCAGGGTGGGGGGTGATTACCTCGTTGCTGAGGACCATTTGGACAGTAAAAACCA
AGTGCAGGACCCTAGCTTTGGTGGTGGTATACGCGAAGTCGATAACATCCTTAGAGCAGA
GGAAGTCAACCTGGCCCAGGGTCAGTGTGAAGAACGGCAGATGGAATCAACCAAGGAAGA
TGATTTCTAAAGATTTGTATTCTCTGCTCTGCCTTCTTCCCCTCAGGATGGATGCCTGGG
GTGATTGCCATGTCGACCAGGGTCACCTGCAGGGCAATTGACTCCATTCGTTGGGAATGG
GAGAATCAATGTGAGTAATGAAGATCTTATCTTGTCTTAATCAATCATAAGAGGTGCACT
TGAGGGAAGAAAAGCGAGGTCACTTCTGGACTCATGATGACCACTGGTGGCGTCTGAACC
ATGGACTGTGAATGGTCCACGTGTGGAACTCTGAGGCCCAACACAGAGAACGGTCTAGGC
CCCTTCTATGATTGGAAGCGCCAGTGAGGAGAGATGGTGTACAGTTTCAAGGACCTAGGG
CTTCTCCTTTCAGGACTAATATGCCTTGACTGCAGGATTGTTGTTAAAAAATCAAAGAGA
GAATCTGTCAAAAACAGTTAAATGCACAAGACATTAAAGCGGGAAGCATTCTATAACTCT
CAATATGTACCTATTTGGATATATTGAAAGAATGGTATCATTTTCAGTGGGGAAAACTTC
CTAATTTGGCCACGGCTCATTTGGACAGTTAAACAGTGTCCATAGCCTTCCCGTTGATGG
TGCCTGGACAGGTTTTGTTCGGGTTCTTTAGAGAAAAGGAGGGTCAATCTCTCTTGGTTG
CTAGCATGATGAAGGAAAGGTGGAATGTTTTCCCAGTGTTGTGTCCTCGGTTCTGGCTTG
TACCCTTCAGGATCAAGGTCCAGGCTGACTTCCATTTCTGCCAGGGTCACGTGTGGTACA
AACGACTCCGTGTTAGGGGAACTTGGAAATGGATGTGAGTAGTTGTTGAAGATCTTTCCT
GGATGACAGAAAAAAGCATGTCTGACCCTCTTCTGGGCCATCGATGTTCCCTGGTAGCGC
CCGAGTCACAGACAGTGAACAGGGACCACGGAAAGGGACATGCCTTCACGTTCTTTTCTG
AGGCATGCTTCTGTACACCGTGCCATGTCCTTGGCTTTGTGCCTCCCGATCAAGCCCAGG
GAGTATTGAATATCTTTCTAAAAATCAACAAAAGTGCCCATAAGATGCTGTGATAATATG
TAATACCTGAAAAGTGAAAGGTTTATCTAATGATGTGCCCATATGGAATCGTCAAAAATG
CTATTTGTTGAAGCCCCAGAAGCTTCTTTAGAAAGATGTCATTCCAGGTGGGTTTCCTCT
ATGGTCAAAGACCACGTAGACAGAAAAGTCCTTGGTCTTTGGCTGGTTGGTGGCCTATGC
TGTTGTTCAAATCATTAAGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved