Echinops_telfairi Locus Mono:270:SNORA32
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:270:SNORA32
Echinops_telfairi
Mono:270:SNORA32
scaffold_195996
SNORA32
1001..1127
2127
CCTAAGACCATCATGAAATATGTGTTTCCTGATGGTCTTATGTGACCTCTGTGAAAGTC
ATTTGACCCCCCAGAGGGGTCACGACCCATAGGTTGAGAACCACTGCTCTATAAGGTATT
AAATGGGTTTTGGTTTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TCACAGCGACCCTATAGGGCAGAGCTGAACTGCCCTGTGGATCTTTGGGGCTTGTACATC
TTTATGGGAACAGATATCTACACCTTCCTCCCAAGGAGCTGGTGGGCTTGAACCCCCTTT
GGGGGTCCAATGACCCTTTCACAGGTGGGCCCAGCCCAACACATAACCCGCCACCTGGGC
TCCTCCAGCCCTCCCTAAAGTCTGTTTCATCTGTGCTCCTTTTCAGTTTTCTTTTTAATA
CAGAGGAGGGGGCTTCAAAAAGTTCACGGGAAAATGGAACTGAGATATAATGGAGTTTTT
CCACAAACGTTTTAAAGCTTCCTCCTCTGTAATAAAACACTGGCCATTCTACAACCGACA
CCGCACGATTCTGACATGAATTAGGTCTAGGTGTTGGTCAGTCATCACCCTTTCCAGTCC
CCCAAATTTCTATCTCCCTTAACTGAAGCTCAGTGCTCCCTAAGCAGGGAGGCATCCTCC
CGCACACATCCTCCCAGCCCTGCGCGCCGCTGAGAGGAAACTCCGGTCCCTGTGTTCCTG
CTAGCTTGGGAAGCCAATTTCCATGGAAGCCCTGGCAGGTTGCATGACACACACTGCCTT
GGCAGCCCCAGGCCTGGCCTGACTCACAGGAGAAGAGTCAAGGAGCATCCCAGAAGCCGG
GATTCGGACAGTTTCACAGCTGTTCGTCTGGCCTGTGTTGTTAGTATCCTTGGGAGGTCT
CAAAATGTTTGTGGATGGATGGAATGAAAAGATAATGGAAGTGGTCGTCACCAAGGCTTT
TAGAATGCAGCTTCGGATCTGCTTTGGACAAGACCACAAAAAAATTTCCCAAGAGGTTTT
TGCTCTTTTCTTGCGACCTTGCTAGCATCCCACCAACTGGGGGCACCAACTGCTGAGATC
TACACTCATAGGATTATTAAAGCTACACATTTTCTACAGGCTCGAGCATGAAACTCAGTG
AAGTTTTAGTTTTGTGCAGAAAAAAATTTTAAAAATAAATAAGCGATCATGGAAATGTCT
CATGAACTTTGGGAAGCCCCTTGGACTTAATTAACGGGCACTGCTGCCTACGAGCTACAG
AACTGATCCTGAGCAGCTCTGAGTAGGTCACCGTTGGCCGGCAGCACTGAGACAGACTTT
GGGGATTGTCTGTAGCCGGAGACGATGAACATGACCCCTAGACTCCTCACCCACCTAGCC
ACAGTGGCACCCAGTCACAGACACACATACCTGAAAAAAAAGTCACATACATGCAGAAAG
TCACACCCAGGCACAGAAATACAGTCACAGGTATCAATGCACATGCTGACCCACACAAGC
ATGCATGCCAACACGCACACGTCCATGCAACCTCAGGAATCATCCCAGCAAGCAGAGTTT
AAATACCAAAAAAAATGGCCTTACCTTCTTCAGAGGGAAAGCTCACTCTCCCAGGAACAA
TGCCTTTCCTCGGGAGCCACCCTCCAATCCCGTGCGTGTCTCTGCAGTGCTGTGGTCACC
GGTGCTCAGCACGAAACACTTTCAGGTGCTGGAGGAATTCCGGCTTTTATAACCCACAGA
GACTGGCCCAAATTGTATAACTGCTCTAACAAATCAGAAATGCTGCTGGCGTTACACCAC
AGCCCCCACCTGGTTCCCGACGGTTACTGCATGCTGCTGTGAGTCTCCTCCTCTGTGTGA
GCCCACAGGGCAAGCTATTACAGAAACCAGATGCTGAGCTTACGTGTCTGAAATGCGCAT
AAATAAAGGAAATAGAAGCCTCTGTCTCCAAACCCTTTGGCTCAATGCGAGCCGGTCCAC
CCACACTGCTCCCAGCTCTGTGAAAAGGTGGATTCATTTTTACTCTTTGGTGATATCTCA
TTACCCCAATGGGGAGGTGGGGGATACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved