Echinops_telfairi Locus Mono:622:SNORA13
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:622:SNORA13
Echinops_telfairi
Mono:622:SNORA13
GeneScaffold_2805
SNORA13
1001..1139
2139
AAGAAAAAAACAAAAACAAATTTCAAAGTCAACTCATATGCTAATGTATTCATGGGGCA
AAAATTTTAAAGATACATATTTTCTGTTGTTGATGATTTTGTTTTGTTAACTCTTATCTA
CTATTGTCCCACACTAGTGTATTACAAATATATTATTTTCAGGAAATACATTTGTAAAAG
GTCAAAAATAAAAGTTATTACCTCATTATTTAACCTGAGGGATGAGCTGACATACATCAT
TATAGTCTTATTGGATCACAGAATGAAACATTACTCAGAGTTCCAAACACTGGTATTTTT
AGTTTAATAAATTGAGGAAAAGGAAGTTGTCTTTTTTCTATTGTTGGTGGTTGTGTTGCA
AAGTCAATAAAAGCTTGTCAAATTTGTAAATATTTACTTCATGAAGCATTTTGTGTGTGT
GCATGTGGGAACAAATTTTTCCACGAGAAATTAAGTTTAAGCATTGATTCAGAACAGTGC
ACCATATAGCATTGAGATGTCAAACCACCAAAGAGTTTTACCTGTACAGTGTATTGGAAG
TACTGAACAAATTCTTAAATCAATGACATACGTTTAACTAGAGGGATCTGTTCTCCGTAG
GATCCTTGTAACGCTCCATCAAAATGCTTTGGATCAAAACAAGGCACTCATCGGATAGAG
CCAATGCAGAGGGCCAGCCTAAGTATCGTTTGAGCACTTTCACATGCCAATAGATTGTGG
GCATTCAAGGACTAAGGCACAGAAGGTGAGGCGTCCTTGAGTTTGGAGGGAAGAGGAGAG
GCAGGGAATAGGTAGAAGTTCTATTCTTTCTGAGAGGGGACGTTCTCCACGGAATAGTTG
CGGGAGCCTGTCCACATAGACGGGGAAGGGTAGAAACTGTAGATGGCTTTGGGAACTCTT
AGCCAGAGATTCAACCTCCATAAAGATTCCAAGCTTTGAAACCCCAGCTCTATTCAAGAC
TAGACATGACGGTGAAACTGCTATTGAAAAAATAGATGGCCGGCCTTTGTGTTGCCCATT
CACGTACGGAAACTAGTGAGCGTGGTGTCAAGAAAGGTGCAAGTTAAACACCCTCACTCA
CAGCCACGTTATGCTTTTGAATTTGGTTTCTTTGGCATAGGAGCTGCCTAAGGAACAGTT
ATTCAAGTAAATAAATAAATAAAATATTAACAATTTAGAAAAAGAAAAAATAGATGGCAT
TGCTGTGATTCTTATCTTTCCTCATTTCCACGTGGAATGTACTCTTTAAAAACATATGTG
ACTGGGCAGACAGGAAAAGAGGATCTTACCTCGATGTTCACATGCCCCCAAGAGATTGAT
GATGTTTGGATGATGTCCGAGTTTACAAAGAACTTCAAGTTCCCCCCCAAAGTCCCTGTG
CCTCTCTCAAAGGTGGAGGCATATTCTGGAAGGCAGTCAAGAATTGCCTCTAACCGTCTT
AGGCCGCTCCAGAGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNATCCACATACATTAAATGACACATAACTATGTTGCATATATAAATATGAT
AGGATAAATACATGTGATTTATGTATTAACTCCAATTAGCAATCTTTTTTTTTTTTAATG
TTTAGTTTATCCCAGTGCAGGTTACTCTCTGTGACGACTTATCACTCTGATGGCTACATC
TTGTGTAGGCTGGGATAGTCCTGTTTGGGGGCGGATTTCCAACAGAATCATTCAGAGAAC
CATTTTGACTTCCAACATGCTTCCTGTTTGACCAAGAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved