Echinops_telfairi Locus Mono:123:SNORA42
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:123:SNORA42
Echinops_telfairi
Mono:123:SNORA42
scaffold_193563
SNORA42
1001..1109
2109
CAGGATGGGGCCGAACTGCCTCTGTGGGCTCCGAAACTGTCTTGACAGAGTTGATACTT
CATCCTTCTCCCCAGAAATGGCTGCTGGTTTCCATCGCTGACCTTGAGGTTAGTGGTCTA
ACTAACCACTATACCACATAGCCACTATACCACCATGTGTGTGTATGTATCTGCACTCAC
CACATTTTTATATGACACATTTAATCAAAATTTACAACTATATTCTTACTAAAAGAAGAC
AGAAAACCAAGCAAAAACAATGGAAAGCAAGAGTTTCTGCCAAACATAAACATATTTCTG
TTTAGCAAATAGAAAGAGTAGATAAAACATTCCCATTTCTCTTCTCACACAACAGAATGT
TCTATGCTTACTGTATTAGTTAACAAATTCAAGTCTGTTTATTTTGTTTGAAATTCCACT
TCATCCATAAATTACAGCTCTCTGCACAATAACACCAGAAGGACAATAAAACCATTGTTT
GCTTTTATAATCATTTCAGACTACAAAATGCTGTACTATTGTAAGATGCTGTCATCAAGA
CCTTATTTCTTCCTCCTCTTTCCAGGGTCTCTACTAATAGCATTCAAGTTATTTAGACTC
TCCACAATAGTCTTGCTACCAGGGCAGACTTCTCTAAAGCTGGAGCCCCAGCGTGGTGAC
CAAATAACCCCTGACGATTCATCTTTCCACACGTCATTATCCCAGAGGCCTTGCAGAAGC
TGAATTGCTGCATGGGCAATGGGGGTGGGGGGGGGAGCTTCTGCCACAGAAGCTGGCTCG
TTCCATTGGACAAAGAGGCCTTTCTGCTCGGCTATCTCTTCAGGCACATGCGCTGTGAAA
TGCTTTCAGAGAGAGGAGTGATGAGGTAGGTCATGTATAACGAGTCCCAACTTTCTGGAA
TAAAGACTTTGTTCAATGAAAAAAAAAAGGTATAATTAGTTTGGGTTCAATCCCTTTTTG
TCATTACAAACAAACTATACACATTTAAAGGAAAAAAAAGCTCATTAAAATATGAAAAGT
CACAGTGTCCCATGCCAAAGCAAACTGTCACCCCGAACCATTGCCTGGCTTTACCCCGTG
GGCTTCTGCACTGAAGCGGGTTGCACAGTAGGGGGGGGAAATATATATATATATATATAT
ATATATAAAATCAATCTTCTTCTTTCAACCCAGGACACACTGCTCTTGAGTGGATTGCAA
CTCAAGTGCCCCGCTAGGACTGAATAGAACTGCTCCTGGGGTTTCTGTGATGGTCAGTCT
AGGGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTTATCGTCTGTATATTTGGGATGTA
GATCAAGGCCTCTGTCTTGTGTTAGCCAAGGATAGACATGTGATTCAAGTTCCCGCTCCT
TAGAGGGAATAGCAACCAGAGTGACTCAGGAGTTGAACCAATGTTTGAAGGAGACTGAGG
GGTCCTCGTGACGGAGTGAGTTACAAGTTGGGCAGCTAACCGCAGGTCAGTCATTGGAAG
CCACCAGCCAGTCCAAGGGAGAACGATGAGGCTTTCTATTCCCACGGAGAGTTACGTCTC
AGAAACCCACAGGGGCAGCTCTTCCCTGCCTGTATGTAGTGTTGCAATGAGTTGGAATCG
ACTCAGTGGCAGTGAATGAGAGAGCATCCCGAGACAACAGTGATGGGACACCTACTGTCG
AACTGTCTGGGACTGCCAGGAGCTGGCTCTCCAGTGCCTCGACCGTTCTGTGGAGTAACT
CATACTGATCCAATGTGTTGACCACCTATCCTTTGGTAATGACTGCTTTCCATTTCTTTA
CATCACGGCATCATGGTCTCTTTAAGTGACCCTCTATTAGTGAACACTTATGGTTTCTAT
TGTCTTATTACCAAAAAATATTACATGTATATCCTTCTTGACCACATGTGTGAGCATATC
TTTGGGGGATATACTTTCAGAGCTGGAAGAACTGGGGTAAAAAAATGTACCTTTTAAATT
ACATTGAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved