Echinops_telfairi Locus Mono:532:SNORD65
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:532:SNORD65
Echinops_telfairi
Mono:532:SNORD65
GeneScaffold_8019
SNORD65
1001..1071
2071
CGTTTGGTTCGATGGGATAGCTACACTGTTTAACTTCCTTTTAGCTTTAAAAATGCTAA
GACAGTGGGACTGACCTTGAATTGGGATTTTGACACTAATAAGTCATTGGGTAGTACAGA
CCCTTACAGGCGTCTTGAGTCGAAAGCTAAATATCTGGTGGCTCAACGTGGCTGAGCTGG
TAGTATTGGAAATGAAGTGAAATTGATATAGTCCAGACTTCCTGTATGCGTAATTTTTAA
GGTGACCAGACGTCCCAGTTTTTAACAATTTTCCCGCCCCCCCCCACCCCCCAGGGTATA
TACTGTTTTCGGCTGCCATGTGGCTATTTCGCCAGGATATGAGTTTTATCAATGGTGTCC
CGCTTTACCGATGCTAACATCTGGTCACCTTAATAATTTTGTTACTGGTCCTCAGATCAG
TTGATCTGAGTGATCTATTTATGCTCACCCGGGTTAAACGTTGGAGGGAGGGTTGGCGGC
AAAGCAGAATGCTGCCGCCTGTGGAGGGGAAGGGCCTAAAGTAAGGCAAGTCCGAACTTG
TGTGAACTTGGCTTTTCACACAAAGGAGCCATTGTAGTCCCGATTTGTGTTGAGGGGTTG
GCCACCTAGCAAGATCTGGAGCATGTAAACAGAAGGGGTGCACCTATTCTGCTGTGGATA
ATCTTGAGCAGGTAGCTGAGGGGGCAGTTTTCCTCATCCCAAGATCACCCCATTTTAAAT
CAAGTGAGATGGCCGAATGGAAGTCGAAACTTCCAAAGAATTGGGACTTGTTTGACTTAA
GATGACCAGAAAGGCAATTTCATTAAGTGGGCTTTTCATTGGTAGTGAGGCTGTCGTCAG
AAGTGCTCTCTGGTTTGTGTTGTGTGTCCTCTGAGGTGTGTCGCATTCCCCAGGTTTTGA
CAACTGAACGCTGCAGAATAGGACCTTCAGAGGTGGCAGCCCCAGCTCAACGTGAAAGGT
AAGCCTCTGTCCTGGACAACTTAACCACACAAAAGGATATCATGTGATGAAATAACCTGA
AATAGCTGGAATTACCGGCAGATGGTATGGTGGTGAGTCTGGTTTTCTGAAGATATCTCA
CGCTATGGGGTGACTGTTGGCTAAGGTGGGAAGTGAGATGACCGACCGTCCAGTTTCTTT
ACAGGTCACCGGAAGCAGAGGCAGAATCTGAGTCCAGGATGGTGGGGCCACTGAACGTGG
ACAGAAGCTCGTTGATTATCCATGTTCAAGAGATGTAACTGGCTGCTCTTCCAGGACAAG
CAACTTTGGTGTTAACAGCATTGTCCCGTCAAGCCCCAGAGGCATTTTACATTCTAACAT
TTGGCTTTGTTCAAGTTCTTAAAAGAAGCTGTAAATCCCAATTTACTTTAAATGCACCGA
CTCAATTATAAAGGATTCTCTTTGGTACTGATTCTTAGAAACATGTATTTGTGAATAAAA
AGATTTAAGTTTGACACAAGCTGTGGTCATCAGTCTTAGCTTTTATCCCTCTTGGTGACT
TTCCAAGAGTAAGGCATCTCCAGTTCTGGGTGGTCTTTGCATAGCTCCTGAAGTCTCAGT
GCAGACATGGGTCCTGGGGCTCCAGCAGCGTCCTATGTTGTCAAACCTTGGCTTAGCTGC
TTGGGGTTCCCCTCCATGTGCTTGTTCACCAACCTCTTATTTAAGGGAATTCTCATCATA
GATCTTGAGCTTCTAGTTGAAAATGTATTAACCTGGGATGGGATATTTTGGGAAATTACA
AATGCCCAGGGACAAGTGGGTGAGGCCAATTCTAGTAGGTATTCTGGGCTGCCTGTAGGC
TGGATTGGTTGTTAGAAACAAGTTGAAGGGTGGGTCCCAAAATGAAGGCCCAGGTGCCTT
TAGAATGGAGTTTGGGGGGGAAGTCTATTTCTTAACTCAGCAGGGCTTGGTAAAAGATAA
ATGGAGTCTAAAGAGCATATTTAATGCTGGTCTTGGAGCCCTGACAACCAATATTTAATG
ATTGCTCAGTTATGCACATTGGCTCAAGTTTAAGGGCACTGATTTGAGATCTGGAGGTGC
CACAAATCAGTGCTCATATTTTGGGGTGAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved